Description :
From Genome Similarity Track
Location :
Scaffold_17:692299- 693593
Sequence
1294 bases(100 bases per row)
CGGCGATCCAATTTTTCGATGATTGCATCATTTGTTTCAACTTGATTAGCACTTCCGCTTCATTTTGGTGACGGTGAAATCTTTGGCTCGAATTCGGGCA
CGCGCACCATTGTGGTGGAGTGGTTCTCGCAAAATTTACGATCCACTTTTAAACAGCGTGCCGCGGACTACCGACTCACTGTTGCTGAGGGCTCACCTTG
TGTACCCGTCGGTGGGGCTGGCTATACCCCTCTGGTGGACTTGAAAGTTGGTTGGCTTGGGTTGGTTCCGTCTTGGCAGGACGCAGGATGATTGGGGGTG
GCGTAGCGTGGAAACCCTTCAGGCTACGCGCCAGGTTGGTTGTCAACCTTGATTGACGTGGGGTGTTGAATTTCCTTTACAGGGTCTTGTTTTTTTTCCT
TGCTAGCCTTGACCGCTTCCTATATGGGGGGGGGTCGTTGAAGTCGGAAGTGAAGTCGACCTACCAAGCTGCAAACTCCGGCGACTGACACGTGCACTTG
GCAGACTTATCTTGATTTCTGTATGGGCCAATATACCTCCCGCCACTTGTTGCTGATGAGGCAAATTCCACTCTGATAATACGTTAGGTCTTTGCGGTTC
ACTACATTGCATATCTAATGACCACCAAACTGGCTTTTTAAGGTTATCGAACTTACTAGGCATGGGTACAAATCAGTCGATTTACTTAGTAGATCGTGTA
TCGAAATGAATGTACCGTATCGATCCGATTTCGTCGATTGCGTATGCACTCGCTGATGCGCCTTCGTCACTGGTGGTATTCCAACACCCAGTCGGTCGTA
GCCCATCAATTCACTTCCCAGCTTAATCAACGGGCGTTTCACCACAGTATTCTCACCATAAGTACGATTCCATGTGGTAACTGACAGCTGCACCAGTATT
ATTGCTGGAGCGGATCTCAAATTACATTACTCAGAGTTTTTATCTGAGGGACCCCATCGGCTCCAAGCGGCAAAGTTTGACGGAATTGACAATACTAGAT
CTTGATGAGACAGCGCAATATTTTTTCACAGCCGTAAAAACTTCAAGCAAGATAATTGGGGAGTGGCTTTCAGTGCTGTAGACAGCACTCTTTGAACCGC
TACTTGCGTTTGCACAGACCTATTTTGAGGCCAGGCGGCTGTGGAGGTATATCTGGGGTATTTCCGTCTAGTAATGAGGGTCCTGAGAGCCAACGCGTTC
TACGCCAGCATCAACCGGTGGGGCTTTGCAGCGCCCAGATATCAAGGCTCTCGGGTTCTTTGTAATAAACGTTGGCGTTCGTGCTGACCCGAAC