Description :
From Genome Similarity Track
Location :
Scaffold_8:69229- 74590
Transcript NameFunction/comments
Hyaar_Emoy2801570hypothetical protein
Hyaar_Emoy2801571predicted protein

Sequence
5361 bases(100 bases per row)
ATTCCAACTTCACGCGATCCCACGTTCGAGTCACTGACTCGATATTAGGCACTCCGATCTGCGATAACTCTAGATTCTTGATATTTCTCGCGTTGATCTT
CGACCTTTTTTTACATTTTGATCTTCTTTTGACCTTTGCCCTTCGATCCTAGAGCTTGTATCTTCTGTCGCGCCAATCCGTATGAATTCTTGGTCGTTTT
CTTCGTGTTGACATCTGGTGACGTATCGACGAAGGCATATGGTTTGGCTTTTGCCGTTGGACTTTCATCCAGCAGATCGCTCTGAAAAGAGAGATCTGCG
GTGGTCCCCGAAGAGAACTCAGGAGAGGGTCGAGGTTTATCTTCCATATCGAGTGATCGATCTCCTCGTTTGTTTTCTTGTCATCAAAGCCCCTCCCAAA
GCTTTGTTGATCTGGAGATCCTTCATCTTCACATGTTCGCGACGATCTCTCTTTCGCTGACGCTTCAATCCCAGGTTCAGTTTTGATCCTGACATCTTCT
CCAAGGGACTCACGGTGAAATCCCGAGTCACCAGGAGATCCGGGCACGCGCACCATTATGGTGGAGTGGGATTCGCTCATTTTATGAGGCGATTTCAACT
CTCCATTAGCGCCTCGACGACCGACTAACAGAGGGAGTACTCCGATTCCGTATAAATGTATTCTTCCTTACCTTGTGTACCCGTCGGTAGGGCGTGTTGC
ACTCTTCCAGGTGGACTCGAGTCGATGCCAAACTTGACCTTGGTTGGGATTGGTGTCGATCGCGTGGAAATCTTCACACGATCGCGTTGGTTTTGGGTGG
GTCTCTGTACGAGTTGCCCTGATCTGATACAGATCGCCTTGTCGTACGGTAATGCTTGAGCCTGCGAGCCTTCTGACCACTTGAGCCGTCTCGAGATTTA
CACCCCTTGCCCTTGCTGTGTTTGCTGCTTCCGATCGCAGTTGACTTAGTGTCTTGAGAGTTCTTGAACGCACCTGGCCAAACAATCCAGGTGCGACACT
TGTGTAGACGTGTAACGCGGCTCTTTATTCGTTGGGAGGCCAAAGATCCTGCCTGGAAGAGATAGCGTGTGTCTTTTGAAGCAAACTGAACTCTGTTCAA
TATTAGCCAATCAAACCCCAAAACCTATCACTGTGCCTATCTGTATCTCCTAACCGGATGCCACGCGTCGCCTTTTCAGGAGATCGTCCCCTCGTATTTA
TGTGGTCCACTTCGGATGCCACGACCACTCGGTCATGGATGCCGATCGCAAGTTGGAAATCATGATCGCAGGTTGGGATCGCGATCGCAAGTTGGGGATC
CTGATCGCAGGTTGGGATCGCGGTGTCAAGTTGGGGATCGTGATCGCAGGTTGAGATCGCGGTATCAAGTTGGGGATCGTGATCGCAGGTTGGGATCACG
ACCTCAAGTTGGGGATCGCGATCGCAAGTTGGGGATCGCGATCGCAAGTTGGGGATCGTGATCCCAGGTCGAGATCGTGAGTCCGGTCCTGCCGTGTCTC
ACGACGGATTACGTAATTAAACCGTTTTACCGCCATCTGGCCTAGTCCCATGTAGTGGCGATCCTGCTCTCTGGGTTGGGTGCGCTATTGCGAGCCACCC
GTCCCAGTTTGTGTCCGCCAATCATATCCCTTTCGACTTAACTGAAGTGTACAATCTGTGCAGTCCCAACTTCAACTCAACCGGAAATTTTCTTGCAGCC
GCTTTGCCACAGAGGTCTGATCATCTCATGTCCCTCGTCCCAAGACCGACTGCATGGCTCACGTCATCTTCACCTCCATCACCTATAGAACAGTAATAAT
AATAATAAACGCCTGCACAGCGCCATCTCCAGTCAGCACTCTCTGCATTCACTCATCACTCTCTACATTTAGTGACTATTATCGGATGCCCTATCCCTTA
TGCGACGTTAAGAGATGCCGCCGGTCTTCGATCTCCTCCCCGTGCCATCACCACCAACATCCCTGAAAACGTCGCCACACTTACGCCAGTGCGCACGGCA
TGCAGACTTCTTCACCTTTCTAGCATCTCCTGCATACACGACTGACTGCAAAACAGAGGCTGATTGGAGTCGACGAGCTTGCGATTCAGCGTGAGTACTT
ATAAAACTGTAAAAGGCATGACACCTCCAATGTAGCAGCCGCTCTGTTTAGAGAAAACATGGAGCGGATGATGGGCGACGTAGTCTGTGGCAAAAGGCAA
GATCATGCAAAAACATTGTTTGCATATAGGTTTTTTCGTTTGGCAGCCACAGTCGACTGAAGACTACGTTTACAAACGCAAAGCGAAGTCTCAACAAGTT
CAGGCTGATGGGCAGTCGGGTGAAGGCGTACGGGCGAGAATTTGGCACATCTTCACAACGTGGCGTCAAACAAACACTTGGCGAGACAGGGGTGCAGCTC
TCGACCGAGCAGCCACAATAGGTATTTGCGCGAGTACGGGCAGTTGTTGGGCTTCCTGCATGGCCCGACTCATAGCAACAGTGAAGAGGGAATAACGAAA
AGCAGCATCAACCACCCATTATTTACATCTCGCATAATATGTTCAACGCTATTAAAACGGAGTCGTTTGGCACCTCGATGTCGACTCATCACATCCTGGA
GCTGAAGCGTGAGACAGTTTGGTTCCTATCTTCTATAGATATTTTAAAGACAAAATTTAAAAAGTAAAATAAAATAATTTAAAATAGCCATACCTTTAAT
ATTACCATTATTAAAGCTAACCATTTCACCTGCTTAAATTTTCGAAATCATTAGGCGTCAAGAGTAAATTTTTATTTAGTAGCTATTCTTTTTATTATTG
TTGATTTAGAAGTTTTTTGTTTTTCCTTGGGTTTTAACTTTGATTCAAAAAATAAAAGAAAAACAATTAATACAAAAAACATTATCATCAATAAATAAAT
ATATAATATTGTTGTTATTAAGACTAATAAATCAGATATCTTAGAAGAAATTTTGACTAAAAGAGAAATTTTAAAATAATTAGATAAAAATCCATAAATG
TTGAATATCGACTTCTTTCGGATTTTGCGCCACAGGTTTGAGAGAGAATTTTTAATCTGAACTAAACACATTCGACAATTACCTGCAATTTGTAAATTTT
CTTGAAAACAAAATTTAGGAATTTCGATTTTACAATACCACATGACTTTTTTGAATGAACTCGCAAAATTACTTTGTAGCTTGGAATAAAAAGTACCTAA
TTTAAATAATTAGGTTTCACAAAAAATTAATAATGATTTAAATTTATTTAAAAATTACACAATATACTCAAAATCATTCTTATCAACTAGTAGATCCGAG
TCCTTGGCCTTCTATGATTTCATCTTTTTTGTGTTATAAGATAGGGGAGCAAGCTCTAGAGCTCGCCCTTTGATATAAGTAATCCAGTTCGGAGAACTGA
ATCAAGTTACAAAACACTGTACAACGACAGACACTGAAGAATAAGTATAATGCTGTTAATGTCTGTATTAACCCAGTACATTATGGTAGGGCAACGCGAT
CTGCCTGTGCTTATGAGCGTCTAGCATTTGCTTACGTGATCATATTCACCCTTGATCGAATTTAAGCCAATCACGTGCGTGAACCACTATAGTGACCTAG
CCAAAGAGTGATTAAATACGTCTATATACCTATTATGAGGGGACAGGCTAGATCGCACTTAGTACGTGTAAGGTACACCTAACCGCGTTATTCACAGACA
CACACAGATACACAGATAAGTACGATTTAAAAGTTAGGCATTCAACCTTGCGCACACTCACTAGTAAGCTTCACCCTTCAGGCTCACTATAATTGATTCA
ATAGATTTAAAATACGTTTTAAAAAAATGAAATACATGCATGCATCGGCTGCTTGAGCGCTAGCCGGGGGGTCACCATAAATTTTACTGAAAGTAGCTAC
GATAAGCCCTTGGGTCACCCAGCGCTTACATCCACAGTTCAGATTTCTCAGCACCTTGCTTGAGTGAAAACGTTAGGCGGACAAGCCGAGTCTTCTCTCT
TTCATACGTTCACTTTTCAGTATGTCATTTGTTCGAGTCGAGTTCATTACCAACCGTGGCAGATATAGGCACAATTCTGTCCACTACATATACCATAAGC
ACAGCATGACCAATTCCAGTAAGCTTGACAAGACAGATGGTATTATCCCTATCGACTACCCTTCACGAAGCCTTCCTGCCTTTTTTGCGGCTCACCCAGT
ATGACACACATCATCGAGCCTTCTCAGTAATTTAATTCTCATAACTAGACTCAACAGCTTAGATGCTTTTCATACGCATACAATGCTACGAATGTAGATC
AATGCGCGGCGCTGCTTGCAGGAGATTTCTTAACGATGAATAGCGTAAAAGGATCAGCAGCTGAGCAGTACGCGAATCTCCGTGAACTATCTTCTTGTCC
ATCTGATTTTCCTGGTATCATCAGCACAGATGGAGTCGAAAGGTCATGGAACTGACGAGACAATGCCCTCGAGTCTTCCAGTAATGGCAGCACGTGGTTG
CGAAACTCTTCAAAACCTGCACTCTATGACCACAGAAAGCACGCGGAGCCACAACCATCAGTCTGTGCTCACCACCACAGTATCCGCAAACAACAACTAC
TTTCCAAAAACTCCATCGCAAATGTCCCGACTCCAACAAGTCCTCCACCCGGAACGCAATTGACGCGACCAGTCCATCTCTTTGCACCTGTTAGTTCCAT
CCCCACACATGAGCTGATATCGATTTCAGCTACTACAACCTGTTGTTCGTCAATCTCACGCACCAAAGAAGCTCGTATCAAAGCGCCAGTCACGAATACC
GTACAACGGCAAAGAGAAGGACTGGTACGCACGATGCTCCCGTGATCGATCCGACACAAACACGAGGCGGTACTGTGACACGTAGCAGCGTCCTCGGCCG
CCGTAAAAACAACCTCCTTGACCTGGATAGCCACTATGCGAACGAATGACCACAGGCTCTTGCTGGAATGTTGCAACCACGAGTAGATGTCCGGAATGCA
AAAGATAAAGTAAACAACAATGAACCACCTACTTGCCACTCTCGACTTTGAGCGTCACGTGCTGAATCTGAAAGAAAAAGTGTTCACTTGGAGACACAAG
AGCCGGCGATCCAGCCGCGTCGTCTTGGAGCTCCACGTTCATACTCATATTCTCAATATTGTCGAATCAAAAATATAGCCACGAGCTGCTTCTCTGCCTC
AGTATTAAACAATCGTAAAAAAGACGGGGGAAGATGCCACTGCTGTCGTACGAAGGTGTGGACGTCGAGCTCCCCTCGAACTTGACTGGTATTGAGTTTG
AGGTCACGACTGGGACACTCACGATCCACTGCTGCAACTTCACGGGGGACGTCGTATTGCG