Description :
From Genome Similarity Track
Location :
contig_6:69221- 71337
Transcript NameFunction/comments
g1766.t1hypothetical protein

Sequence
2116 bases(100 bases per row)
GTGCGTCTGCGACGTGGCCGAACAAACTGGCGACGGCGACTTCAGCACCAGGGCATGGTAGGCCTGCATGGATGCAGGCAGCCACATGTGGCAGCACATG
CCACGCATTCAACTGTAGACACACGTAAATGCCCTGCTGCGAGTGTGACTACCCATCCCCCTTCTGGCATCCCTTCAGTTTGCATCCGACGTGCATTCAT
GGATTTGATGGAGCGCATCAGCTCCTTTCGCTCATCGGCTGTCAACGCACCGGCTCTTTGATTGACGACGTAAAGATCCGCGGATAAGTCGCCGACCGGA
GGGATGCGCCGTACGGATAGCCAGCCACGACTGTTCATAAATCGATAAAGCTTGAGCGATCGGTCGGAAGCGGCAGCGACCGTGTCAAATGGCACGTCTC
GGTTCTGAAAAGCGAGCCGGGCACCGTTGAGATTGCCGACCAACTCTCGGGGTGTAGCCAGACCTTCCGCACAGTGCAACTTTAGTGTTCGATGATATTG
CTTCAAAGGGTTATTTGAAGCGGCATATCCACCAGGTGTGTAGAACGCCTGCCAGCGGGAAAACCGGGTCGAGTTTACCCAAAACCTTTTCACATGATCT
GTGAGTTTACGTACTGAAGAACCGAGACGAAACCTGTCCCATCGCTCCAAAACGCAGGCCTTTACAGCAGGAAATGCATCTTGAGTCGCATAATGCATGT
CGTACAAATCCGCAAACACAACTCGTGTATCTTCCGTGCTCGCACGGAATGTGCGAGCATGTTTCCACACATTCTGCGTCACGTGAAACCAGCACATCAA
AATGGTTGTACCTGGAAGCTCGGCCGAACAGGCGTTGAACTGCGCATTGCAAGCATCTGACATCATGAACTGCGGCGAAATTGCAGCATCCAAACACACG
CGCTTCATGAAGCTGATGCACCATCCGACGTCAATTGCGCGCTCTTGAGATGTGCAAAAGTAAGCGAGAAAAAAGAACTGGCCGCACCGATCTGAGTATC
CAAAGGCGAACACGTTGTAGCCGTTGATCACCATACTGTGGGTGCTGTCAACGTGAAATATCGTAGTGCAATCCGACCGATTCTGCACTGCAATATAGTC
ACGGACGAGACGTAGACGCGTCATGCCAACACGATAAAGAATCCTCAGATCCGTCTCCGAGATGTGAGGCGCTGCTCGCGGTACCGGGCAGATCACTTTG
TTGCGCGTCGCACAGTATCATCATGTCGCGCTCAGGCAGCGACTGTAGATCCAGCTGATCGTACAGATTTCCATCGCAAAGCTGAATCATCGGCGCCATG
GAATCTCGTGGGTTACCCACCTCCAGTTTTGACAAAATCAGTCACTTGAGTGTCTTTCGGAGCAGGACCTGTGATCACACCTGCCTCGACCATGGCGCTG
AGAGTGTAAACAACTTGGTGGCTGTTATTTTGACTCCACTACTTAGCTTCTCGATAATAAACGTCTTCATTGCAGGGAAATCTTGCCCTCCGTTGGAGTT
GGCGGGTCGTTTCTGTGCATGACATGCTCGACTTGCTGAAACACCTCACAGGTGCTAGAGGACAGACAGATCTTCAACTTGTACCGACACGGACATGATG
CCGTCTCTGTCGATGTAGCGTCGTCGTCGGGGGCAGTGAGTCTGGCACGACACCGCTGAGACCGGCACAGTACCATTTGAGACCGCATTTGATGAATGCA
GCAAGCTAGATCGAAGTCCTTATCAAATATATGATCACATACACCCCACTGGGTTACTCTTGTCGATACAGTGAGTTGGCAGTGAGTCCCGAAAGGACTG
TAGTGTGTTAATCTCCATATGTTGGTCCACGTTGGTCAGCGACGCCCTCTTCATCTCCGATTCAGACGTCTGTAGCTGCAGAATTCCATCAGAACTGAAT
AGCAGCTCGCTATCGCGCTCGGACGTTGTTAGTGTTCGCTATTGGCTTTGGCAATGCACGCAAGAGGTGAACAGAGAAGCATATATTGAGCTAAATTGCT
ACAAAAGTCACTTCAACATCTTGAAGTGCTATTTTGGTGTTTGTCTAGTTTTTTTGCTGGTGGTTTTCTGGCGATTTGGTGGTGCATCCTTTTTTCGAGT
GGGCGTGTGCTGCACC