Description :
From Genome Similarity Track
Location :
Scaffold_704:6922- 8889
Sequence
1967 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCCCGTACGAGTACATTACCGCGTTCAATGTGCTAAACCAGACTACTATC
CCGCCTAAGTCTGCTTTTGACAGCAAGCTCCGTGGAACAAGCATCACCACTAACGACTACGAACGAGTGAAATTCGTTTGGGGGTACTACGATATGAAAT
CAATCAAGGACCTACTGATCTGGTACAACAATCTCGAGGTAATTCCATTTTTTTTTAAGGCTATCAAGGCTCAGCGAGAACTCTTCAAGCGTTTCGATCT
GGATATGTTTGCGGATGGAGTGTCGCTACCTGATCTTTCGGAGAAAGTCATGTATCAGACCTGCTTTAATAATCTCCAATATCCGAATTAGGAACCTGCT
AACGCATTCCAATTTCCAGCTAAGCTCATGGGATGGTACAATATTCAGGATGCTAAGGTAAAGCGATAATTTGGTATGACACTCGAGCACTTGAATACAT
TGCTGCAAAAGCAAAAGTATCGATGTGGTCTATGTCACTGCAAGCTGACCGTTGATACGGCTTCAGCAAACCGTATCAACAACAATCTCGCAACATTGAC
GGCAACATCTTGATCAGCTGTGTGAAGTACAACACCGCTCGTAAGGACATGTAGCTCGGGGGATTTCGGTATAAGAAGTTGCTTGAGTTCAACTCAGACA
GCCTGGTATATTCTATTGATCGGGAGGAAGAGCTAAGATGAAGGCCAATATCGCTAGAGGTCCATCTATTATCTTCAATTACTGTGCCAAGCGTTTTGAA
ACTTAAATCCGAAACTCATCAGGGAACCTCGTGAAAAGTATCATAGGCTACGACGCAAATGCTCTGTACCTGTGGGCTCTCGGTGATTATATGCCTTGCG
GGCGCTGACCACCATTGAAGCATACCCGGGTATTGTTGATGACATTGTTAATGACAAGATATTTGGCTTTCTCGAGTGCAATATTCGTACTCCAGACTAT
CTAAAAGACTACTTCAGTGAAATGACCCCCATTTTCAAGAACGTACAAATCGATTGTCCCGACGAGAGTGTCATTGGTAAGCACATGTTCGATTACAACC
ACTCCCGCACATCAAATCGTTCGAAGCCAGCTCGTAAGCTGATTGGTAGCTACTTTGGTGAAAAGATTCGTATATACACACCATTGCTTAAGTTGTACCT
TTCTCGCGGTATGGAGATCACTAAGACCTACTGCTTTATGAAGGCCCTCACAAGCCTTTGCTCCCTTTATGGAGGCTGTATCAAATGCACGACGAGGGGG
TGATGTTGATAAACCTAAGGCGATAATTGCTGAGATGATGAAACTTGTAGGTAACAGTGCTTTTGGTCGCTCTGGAATGGACATGAGCAAATACAAAGAG
GTCAAGTATGAGAGACAAAGCAATTAAGAGCAAGATCGAACACTTTAGCATTCCATGGGTTGGAAGAGCTTAATGATGCTTGTGAAACCACCATGAAGAA
ACGCCGACTCAATAACAAGAACCCGATCCATTTGTCGGTTCCTATGTATCAGCTTGCTAAGCTACGTATGCTTCAGTTCTACTACGACTGCATATATTTC
TACTTCGACCGCTCTGACTTCCAGTATCAGGAGATGAACACCGATTCAGCTTATATCGCTTTCCCATGTGAGAATCCTTTTCAAGACTGTATCAAGCCTG
AGCTACATGCTCACTTCAAGGAGCATAAATATGATTACTTTCCACGTGACTACAACACTGAGGTAGCTAAGTTTGATCACCGTACCCCTGGTCTGTTCAA
AGATGAATGGTCAGGTAGCACGAACTATATTTGTTGTCTACCCGACGAATCTTACGAGGTCAAAGTTTCAGCAAAGGGTGTGCAGCAGGGTCGTGGTCGG
AATGAACATGTCTTTAACCCTGACGGATTTGAGTCTGTTGTACGGTATCGCATCACGCTACAAGATA