Description :
From Genome Similarity Track
Location :
Scaffold_793:6920- 9425
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_793-snap-gene-0.4Phosphatidylinositol 4-phosphate 5-kinase (PIPK-D12/GPCR-PIPK)

Sequence
2505 bases(100 bases per row)
CGGCCGAGATGTACATGGTGGCGGGCGTCGTGGGCGTGCTCGTGGACCTGCTCGTGCTGCTCTCCTACTTCTTCGTGCCCAACATCAAGGCGCAGCACCC
GGCGGCCGACGTCGTCGTCTGGCAAGTCGCCTGCGGGCTCATGACGTCGCTCGGCTTCATCGTCGCGTACGTCATAGAGGGCGTGGTGCGTGTGCATTCT
GTGTGACGTTTGGATGGATGCATGCCATGGATGTCATGGGGAATCTGAAGCACTGACACATTTTCTTCTATGTTTATGGCGTTTAAATGTGCACAAACAG
CATGACGACTGCGCAGTGATGGCGTCTTTTAATCAGGTAGAGAGCGACCACCATGTACGGATTATGTGTGCGTGCGAATAACTGTTATGCTGACGCTGGT
GTGGTGATATCCTGTTCTTTTGTGTCTCTGCTATTGTGCAGTTCTTCATGTTCGCTAGCACCGGCTGGTATCTCATGCTCTCACTTGATCTGTTTGTGGC
GCTCGTGAACCCCTGGATGGGCTACAACTGCAAGTCCTGGGCGTATCACACCATGTGCGTTTGTGCAGTATGTTTCTCGTGCAAACACACAGTGCACCTT
GTCCTCTTGGTTAACTGACACTTCGTTTATCATGTTCTCAGCGTGTGGAGCTTTAGCGGCGTGTCGGCGTTTGTGGTCTACCAGCGGCGTCTCTACGGCG
TGTCGGCAATGAACATGTGCTGGATCAAGCGCACGCATGACGCGGCGACGATCAACAAGGCGAACTGGGCGTTCCTCTACGGCGAGATCATCGGCATCTT
TGCGCTCTCGCTCAGCGTACTGCTCTTTGCGAGCTTCCGCTTCGTGCGCCGCCAGCTAGATGTCACGTATCGAGCCAAGCGCCGCAACTTGCTCCAGTAC
TATCGCTATTTGCTCATCTACGGGGGCTACTGGTCGGCGTGCGGCGGATTGTACTACGCGAGCTATCTGCAGAACTTCCAGGGCGAGATGGCGCAGCGCA
TCGAGGTCGCGTTCGTGTTTGTGTTTGGCTCGTACCCGGTGCTGCTGCTCGTCGTGTGGACCCTGAACACTGAGCTGTACCAGAACCGCTCGAGCGAGAA
CTCACTGCCAAAGTCCGAGCGCGGCAACAGCAACAGCAGCAGCGGAGACGCGCCATCGAGCACCGAACACTTCAGTGCGGCGTTGCGGAAAGATCTGATG
AGATACACGACGGCCGGCATTTGTTGCAGTATCAACGACACGGCGTCGCTGCCGCCTTCAGTGGGCGGAGGTACCATGGACAGCTTGAAATCGCCGCTGC
TGAGCCGCTCGCGCGCGAATTCCATGGACCGCAACGCAATGGCGTCGCTCTCGCTGCTGCAGATGGAAGAGAGCGAGGCGTCTCGTCTGCTCTACAATGA
GAAGAAGCGCCTCGCGACCACTGTCTACAATGGTGAATACCGGTACTACGAGAAGTTGGGCTTCACCGACTACGCGCCAAAGATCTTCCAAAACATCCGC
GAGGTGTGCGGCATCGACAACCTCATGTACGAGCAATCCTTTGCCGACACACTCCTGGAGCGCGCGTCCGAAGGCAAGTCGGGCATGCTCTTCTACTTCA
CGAGCGACCGCAAGTACCTGGTGAAGACCATGACCAAGTGGGAGCACTCGTTCTTGCTGAACGTGCTCCCGCTATACCACCAGTACATCCTCAAGCAGCC
GAACTCATTGCTGTGCCGATTTTTGGGCTGCCACTCGATGCAACTGCCCGTGGGCTGGAACAAGATGTTCTTTGTCGTGATGGAGAACGTCTTTCCCGAT
GGACCAGTCGACGAGCGCTACGATCTGAAAGGCATTTTCCACCAATCGAACCTGAGACACCAGGAGGAGCGCATCCCGACGCCACGATGGAATCGCCGCC
AGCAGCAGCACTCGTTTGTGAACAGCAGCAGCAGCAGCAGCGACGACAACGACGATGGTGGTGAAGGAGAGCAGAAAATGTCCCACTCCATTGAAGCAGC
GCTGGAGGCAGAGCTCAGATATCTCAACAACAACTTCAGGGGCGGCGGCACCAACGAGAATCAACCGCTGCTTCGCCGCGGCAGTTCGCGAAGTTCGCTT
CGTCACGACAACGACTTTGTCTCTCGACGCGCCTCGCTACGCGTGAACTCCACCACACGCGCCAACTTGCTAGCACAGGTGACGAGCGACTGCGGTTTCC
TTCAGGAGCTTGGCATCATGGACTACAGCTGCTTGCTAGGTATTCGACACTTTCATACACCGCTGGACCCTTTTACACTCGACACTCTCGCGCACAATGC
CGTCGTGTCGGAGGACCAGAAGACCGTGTACTATTTGGGTTTTGTCGATATCCTGCAGCACTACAACTTTGGCTGGAAAGTGCAGAACTGCCTGCTCTCT
GTGGTGCTTGACAAGCGGAGCATCACGGCGCTGCCGCCCGCGGAGTACGCGCTACGGTTCCTGAGCTTCATCCACGAGTACCTGCTCCGCGATCCAGACG
CGTCG