Description :
From Genome Similarity Track
Location :
scaffold_678:6920- 8218
Transcript NameFunction/comments
Pl_103017hypothetical protein PHYSODRAFT_478752
Pl_103018protein kinase, putative

Sequence
1298 bases(100 bases per row)
CGTACTATACCGGAGCCGCACGCAATGGCACACCTTACGCTGTGCTTGTTCAAGAAGCATTCGAGTGTGCAAGTGAAATGCGCTCGGTTGGCGATGACAT
GGAAACGACATTAGTCGAGTGCTCTGCAAATTATGTAGACTCGGTGCACAAACACTTTGGGAGCTCACCGTTCATTTTTCAAGTCCAGTTTGACAACGCG
GAATGCACCAAGTTCTCTTCTGGTTTAGGAGTACTCGTGTCAGACAAGTGCGAGGGCAGTTTCGACCACTCGTACACAAACTCGAGCATTGGTAGCTTTA
GCGAAAACGGATCTGTGTCAATTCGGTGGTTCTCTCAAGCTTCATGCGATGAAGAATCGTGGTTAAGGACGGATATTGCTGATTCGAAGGCAATTATGAC
ACATTCGTGCGACGTGAACTGGTGCAAATGGTACAGTAGCAGTAATACCCGTAGATTGACGGTCACAAATGACTCGAGTGGTGACGGCGGCAACGCGGTC
GTAGGTTCCACCTCGCCCACGCCAAGTTCAAGAAAAACTGCATCTCCGACGACAAGCACAGGCACAACTTCCACATCGCACACGACATCGGCAACCACAA
CAACAATTACGATAAATTCAGGTAGCGGTTCTTCAGTAAGCACAAGTAGTGATAGCAGCACCGACTCCAACAGTTCCAAGGCAACCTCAGCGAATTCTGG
AAGCAATACTCTCGATGGAAGTTCAAGCTCGAGTACTGCTGCAGACTCAAACAGTGGTTCTGCTCCAGCGTCGACCCAGTCTGACCATGGCGTTAGCATT
GGTGTTATCATTGGAATTTCTTGTGGTTGTCTTGCTGTCGCATTCGCAATCTGTGCGATTTTCTTCTATCGTCAGGGCCAAAAAGGAAAGAATTCTACGC
AGCAAACAACGACCATGCAATACACGGACATGACCTCTCTCCAAGGAAAGACAATTTCGCAGGGACAGACCGGGTTGTGGAATGACGATGTTATCACTGC
TAAGCGAATCTTTTGTGACGATGTCCAAATCCGAGATATTATCAACCGAGGTGGGTATGGAGAAGTCTACGCTGGGGTCTTCCATGGTCGACCAGTTGCT
GTAAAAATGCTACTTCCTGCTTGTCGCGATCAGATCAAACACGTGAATGATTTTCTAGCAGAAGCTAAAATGGCTGCTATGATGGACCATCCGCGTATTG
TATTACTCGTTGGAGTGGCATGGCATGCGCTCTCCGATCTCTGTGTCGTGTTTGAGTATATGAACGGTGGTGATCTGCGAACTCTACTAAACAAATAT