Description :
From Genome Similarity Track
Location :
Scaffold_135:69162- 70762
Transcript NameFunction/comments
g5314.t1XP_009529947.1 hypothetical protein PHYSODRAFT_334382 [Phytophthora sojae

Sequence
1600 bases(100 bases per row)
GGTATCCTCCAGCCAATACGGCAAGATGTATCCCATGCCAGTCCCATGCTGGGCGTTTTTGGCGTGGAAGCAGATGTGGAACCCGTTCGAATGCACCTGC
GGGTTGTCCGACACCTTGAACACGCTCTTGAAGCCAATACCCTTCTTGCCGATGCTCGCCTCTGAATCAATCGCTGCCTTGGTAGACGCGCCGACGTCAC
AGATTGCTTGGACATTTGCCTGTGAGAATCCCTGTTCATTGTTGTAGAACACGATCTCCTTGTCCGCTGTCAACGTGAAATCACCAAGCGGAACCACCGC
GTCGTCATAAGCGTTATCGTCAGCGTTTTGCAGCAACTCGAGAACAAAGTGAGTGCTCTCGCTGTAGAGCTCGTCGCTGAGCCGCTTCAGAGCACGCTCC
AGGCGCTGCTGTTGAATAAGCAACACAGATGATGTTGCCTCATCCTGAATCTGCAGCCCAACGCCGAACTGCTTTCTGCGCAGATCCTGAATGAACGAGC
GGCATGAGTCTGCGTTAGCGTCGTTCTCCGGCTGAGAGGGGTCCTCGTATTTCAAGGTAACCAGCCTTCGAAAGCTTGCCGATGCCGCGTCTTGATTGGA
AGTGTCGAGGAAATTGGGGGACACGCTCTCGTCTTCGTCGCCCTCGCTAGCTGCATCAGTAGAGGCCTTGGACTTCACTTCGGTGGTATCCTTACGGCTA
TCGTTATCCGCGTTGTCAGCGCTCTCTTCGACGCTAGTAGTCGTCAGATTCTCACGCAGGCTACACCACTTGTCCGTCTGGTTTGACCACAGCGGCGACG
AGCTGCGTTTTGAAATGAACACGAGCGCTTTTCGTTCGGCATCACTTCTGCAAGCCTTCCAGACCCGATCTGCAACATCCCATTCGTTTGGAGGATCCGA
GCCAGCAGCCCGAGTAAGCGCGCCGAGCAGCAACCTCATCACGAAGTCTCCGAACTCGACCGGCGTCTCCAGAAGAACCTCCAGCACAAACCGTTCGGGG
TAGTTGGCTGTTGTTTTGTCCTTTGCGCAGCTGGACAAATAGGAGCGCAAATGCGCTTGAACAAGCAGCTCAGGGTAGCTAGTTTGGCTCCTGCATGTCA
CCACCATCGACACTACGTGAACTGCCACTTGGCTGGCAGCCACCGCAGCTTTGGCTTGCTGAGCTCGCGCAAGCAGCAGCTCAACATCGGACGGTGTCGA
TTTCTCGTTGACGCGCAGAATTGTTCCGTTCAAACAGCACACAAACATGAAGTTGCTTGAAGACGGTGCATGATCAAATAAAATCATTTCATGCACGCGG
ATAAACGAGAGCAAAGACCCACACAACGGGGCATACCGCTCTTGCCAATCCATATACAGCGATACATCAACCAAGTACGGGCACTTGCGCAATTTCTCTA
GCGCTTGCTCCGTCAAGAATTTCTGCTGCATTGACTCACCTGTTGCGTCCTCCGCACCGTCCGCGCTGCCGTCGCCACGGTTTAGATCCAAACTGCCAGT
GAACGTGACAAATGAGGCATCTGGACTGGCAGCCACTGGAACCGAAAGCTTGATAATGTCTTCTACGCTGGGAAGTCCAAGGTCCTCGACGCGAGAGCAT