Description :
From Genome Similarity Track
Location :
scaffold_13:6915- 8302
Transcript NameFunction/comments
g791.t1 dicarboxylate/amino acid:cation (Na or H ) symporter (DAACS) family protein

Sequence
1387 bases(100 bases per row)
TCCTCGATTTGTTCAGCAATGATACGAGCTACGTATCCGTCGCCAACGATGTTGCATACTGTCACGAATCGCCCGAGGAACCAACTAATGGCCACCAGGT
AGCTGTAGCTCGCGGGCACTTCCTCGCTGGGGTATATCGTCGTCCAGATGGAGTAGATCATGACAACACTGGAGTTCGGGATTGGGGCTGTGCCCATAGA
ACCCAGTACGGACAGCAGAAATATGAGGATCAGCTGCAGCCACCCCAACGGAACTGCACCTTCCGTCGTGGAGACCAAGAAAACCAGCGCGCACGGAAAG
TAGATGGCGGAGCCGTTCTTGTGCAGGATGCAGCCAATTGTGACCACAAACTGAAGGAGACTGCGCGGAACTTCCCGAGTGGATTCTACACATCGCAGTG
TCACTGGTAATGTGACGAGCGACGAGGAAGAACCCAATGCAAACATTGCGGCTGGAAGCATGGCACGCATGTATGGGAAGGGGTTCTTCCGCAGGGTGAA
CCAGAGCAAAATGGGGAAGAACACGAGCTCGAAGATGGCAATTGAGAGGATTGTGCACAGGACAAGCACGCCCACGTGTCTTGCTGCTTCACCGAGCATA
TCCTGCCCTGATAGAGAACCAGCCACGAGCGACATCACGGCAATTGGACTCCAGTCTATGGCCTTGCTGATGACGTGGAAGAAGACCTTGTTCATCTGCT
TCAGAACGTCAAGAAGAGGACTGGTCTCACGAGAACTCGTTTTGACTGCCGCGGCTCCGAAGGCGATGGCGAACGTCGTCACACTCAGTATCAGACCTTG
CTCGAAGCTCAAGAAAATGTTGGCTGGCACGAGCTGGTTCAGGATGTCTGTGATTTGCTTGGACACTGTAGCGGCGGCACTCACTGTGCCATCCATCAGA
AGCACTCGCGTCGGGTCGTAGAACTCGAAGCGCGTCGTGCCATCCATTGAAGTCGCTGAGCAGGAGGCTTCGCCCGTGGAATTGTACGTCAAAAAGCTGC
CGTCCTCGCACATGACGTCAAAAAATGCAGAGGACGTCTCGACAACTACACCCTTGGTTTGTGGCACAAGATCGCGCAGTAACATGGAGATTATGAGCGA
CATTGCAGAGCCTACAGATGACAAGGCCGTGAATATTAGGGCCGTGCGAGTGCCGACGGTTGATACTTTTCCGAGCAGTACGATGTCGGCCACAGTCGTG
GACAAACTCGTGAACACCATGGGGACCACGAAGCATTTGAGCACCTGCAAAAATATTTTCCCCGGCACATTCACGATGTTGCTGAAATCGTCCGATACAT
TCAGCTTGGACAGGCCCATACCGAGACCCAGACCTGCCACCGCGCCCAGCATAATCTGCGTCGTGGGCTCCCGTAGCAAAGCGCATC