Description :
From Genome Similarity Track
Location :
Scaffold_131:69145- 72480
Transcript NameFunction/comments
Physo_123574aminophospholipid-transporting P-type ATPase

Sequence
3335 bases(100 bases per row)
CAGGCGCCGGCGGCTGCGGTGGAGCCTCGCGTCGCCTTCCTGAACGACAAGGATGCCAACCAGCAGCTCATCACATCCAAGCAGTACGCGCGCAACGTCA
TGGTCACCTCCAAGTACACGGCCGTGAGCTTCGTGCCCAAATGCATCTTCGAGTTCTTCCGAGTCGTGGCCAACGTCTACTTCCTGCTCATCTCCGTGCT
GCAGGTGCGCATAGCTCTCTAAAGCTACAGCTTTCTCTTTTTTTTACAATCCTCCTTGAATATGCCCATTTAGCTAGCGACACCATGGTCGCCGACGAAT
CGATTCACGACGGCTGGCCCCCTGCTATTTGTCCTACTAGTAACAATGGTGAAACAGGGGAGCGAGGACTTCAAGCGCCACCAGGCAGATGAGAAGCAGA
ATCGCCGCTTGTGTCGGGTAACCAGCCTCTTTTCCTCGTTTTATCGAGCTAGTTTTGCTAGGGTGCTGAAAGACGCTATGCATTTGTCATTTGTCAATAG
ATCATTAACACAGGTGGCCAGACGGAGATGATCGCGTGGCAGGATTTACAGGTCGGCCAGCTCGTGTGCGTGGAGAACCATGAAGAACTACCCGCAGACG
TGGTGATCCTCGCCACTTCCGAGGAAGAAGGCAGGTGCTTCATTGAGACGTCGAATCTGGACGGTGAGACCAATCTCAAGCGCAGGATAGCGGTCAAGCC
CACGGCTCAACTTGTCGGCTGGCGCGAGCTCCACGGCGATGGTTTATCGCAAGAGGCTGTGTGTGCTTCAGCAGTGCGTCGACTGCGCGGGTCAGTGGAG
CACGAACAGCCCAACAATCAGCTGTACACATTCACTGGGCGTCTGCTACTTAACGAGGGCGGTCGGGGCGAGACCGCTGTGCCTCTGGGCCCCGAGAACT
TGCTTCTTCGAGGCTGCAACTTACGAAGTTGCGCGTTTATCGTCGGGCTCGTAATTTTCACGGGCAGTGAGACTAAGTTGCTGCAGAATTCACGCGCCGC
TCCATCGAAGCAGAGCAAACTCTACCGCACTGCGAACCGCTGTATGCTGTTGATCTTCACTACAATGTTCGCGCTCTGTTTGGCGAGTGCGATCGCCGCT
GCGTCTTGGAGCAGCCACAACGCCAGCCGCGTGTGGTACTTGCCTTTCATCAAGGAGGGCGACGGCGCGGACGACTTCATCGTCAACTTCTTCACCTTCC
TCATCCTGTACAACAACCTTGTACCCATTTCGCTGTACGTCTCGCTCGACATCATCAAGGTGCTGCAGGCGAATCGGATCACGTCGGACGCGAGCATGGT
GTTCGAAGGGACCCACGCCGTGGCGCGCACCTCGGAGCTCAACGAAGAGCTCGGCCAGGTCGAGTACGTCTTCAGCGACAAGACGGGCACGCTCACGTGC
AACGTCATGGAGTTCCGCAAGTGCTCGATCGGTGGCATTTCGTACGGATTCGGCACTACGGAGATCGGTCGAGCTGTGGCTGCACTGGCAAGTGTGAAGA
CGCACGCGACTTCGGGTGCATCGAGGCAGACGTCGTCCCCAGCGAAGGCGAAGATCAACCCGCTGGGGTTCATCGGCGAAGGGAGCGGGAGTGCTGTGCG
GCTCGACATCAACTCGACGGACGATATCCGTGAGATTATATCGTCCGCAGGGCCGACTCACTCAATGATTCCATTCGAGGAAGGCGGCGATCCGAAAGAT
GCCCAGGTGCACTTCGATCCCAGCATTCACTTTGATGACCCGTGTCTACTGCGATCGCTGTACGCTGGGGGGAAGCAAGGTGAGCTCATCAATGAGTTCC
TCACGCTGCTGTCGATCTGCCACACCGTGATCCCCGAGACCGACTCCAAGACGGGCGCTGTCACGTATCGAGCTTCATCCCCGGACGAGGAAGCGCTGGT
GAAGGCTGCGAAGTGCCTCGGCTACAACTTCGTGGCCCCTGCACCGCTCATGAAGGTGGAGATATCTCGCAAGCAGTCTCTGCTTCCACCCCATCTGACG
CCGCAGTACAAGCCTGAACCGACTAACAAGTGCTTCACGATTGTGAACGTGAACGAGTTCAACTCGACGAGGAAGCGAATGTCAGTTGTGGCGGTGAACG
AGGAGACCCACGAGTACATTTTGTACTGCAAAGGCGCCGACAACATGATGCTCGAACGGGCCGCAACGGGGCAGAACGATGGCGACGCTGCAGATCACGC
CAAACTGGTTGGACACTTGAAGAACTACGCGCGTGAAGGATTGCGTACGCTGGTACTTGGCCGTCGTGTCCTCACTGAAGGAGAATACAAAGAGTACAAT
AAAGCGTACATTGAAGCGTCGACGTCACTCGAAGACCGCGAAGCTAAGCTGGATGCGTGTGCCGAGCTGGTGGAGCGGAACATGCAGTTGCTGGGCGTGA
CTGCTATTGAGGATAAACTGCAGGACGGAGTTCCCTCCGCCATCTTCGATCTTGCGCAAGCAGGAATCAAGGTCTGGGTGCTCACGGGAGACCGAGAGGA
GACTGCCATCAACATCGGACACGCGTGTCGGCTTATCAACGACAAGATGCAGTTGCTGTACGTGAATGCCGAGCGCATTGATGCACTGAGCGCGCAGCTC
GACGCATTGCACGAGACACCCGAGATCCAGCGCCTCATTCGAAGCGAGCAGGTAGCCGAAAATCTAGCCATGGTTTGCGACGGTAAAGCGCTCGTGCACA
TTTTCCCGTCGCGTGACACGCGCGTGAAGATGTCAGCAGAGGCGGTCGAGCGTGTTAAACTGCTGAGCGAGAAGCTGCTGGACATTGCGCGCGTCTGCAA
GGCGTTGATCGCCTGCCGTGTGAGTCCGTCACAGAAGGCGGAGATCGTTCAGCTCGTACGCAAAGGAGGGCGTCCAGGCAACAAAGCCCAGCAGCCGATC
ACGCTCGCTATTGGGGACGGAGCCAACGACGTCAGTATGATTCAGACGGCGCATGTCGGCGTCGGAATCTGCGGCAAAGAAGGAGTGCAGGCTGTGAACG
CCAGCGACTACGCCGTGGCTCAATTTCGGTTCTTGACGAGACTGGTGCTGCTACACGGGCGATGCAACTACAAACGCGTGTGCAAAGTCATCCGCTACTC
GTTCTACAAGAACATCGCGCTCGTGATCAGCCTCTTCGTCTTCAACTTCTTCAATGGACAGTCAGGCGCTCCGCTCTTCGAGAGTTTCGTGATGGCAGGC
TGGAACTTCTTCCTGGCCCTCCCCATCATCGTCATTGGCGTCTTCGACCAGGACATCCCCGAGGATGTGGTGCTCAAGTTCCCGCAGCTCTATCGACGCG
GGCAGTTTGACAGCGACCTGAACATGCGCGTCTTC