Description :
From Genome Similarity Track
Location :
contig_23:691352- 696061
Transcript NameFunction/comments
g6158.t1hypothetical protein
g6159.t1OWZ02542.1 hypothetical protein PHMEG_00025882 [Phytophthora megakarya

Sequence
4709 bases(100 bases per row)
ATCCAAAAAGGGACGAGGGGAGCGGAGCCCCCATTGTAGGTCATGCAGCATATGCCCACTAGTGAAGAGTTGAATCATCCTTGGAGCCGGTGACCATGTT
AGCAGCGAGGGAAGTGACGGATTCCGCGCAGAGGTTGGTGTAGGTCTTGAAGGTGTCTGAAACCCACCGGCCGTGAAATTGAATCGTCATGGCATTCACT
CCTGCCCGATACATGTGCGTTGCACCCCTGCACGGAAGGAGTGCGGGCTGAAGTTCCTTGGATCCTCACCATTCAGTACAGCGGCCTTCTTGATCGCGCT
CGACAGGTGTGCCGTTGAAATGCACGCCGGATGCCCGGTGCGTCCCAGGTACATTGCCACTGGTAAACCGGGAGGGAGGTCTTGTCTTGATCGTAGAAGG
AGAAGAGCACCGAAGACAGGGCACAGGAATGCGTGGCCTGAACGATACAGCATTCTAGCTGTTGCATGTCCGCACTGATTGGTCTTGGAACCGCGAAGCC
GCATGTGTACCGATTGCGCTTCAGTCGCCGATAGTGTCGGTTCCCCCGCCATGTCCAGGACAACCAGGTCCTCAGCTCTAAGCACGAACCACTTGAACGA
GTTTCCGCTGATGGAGACAATTTCCGAGCGTCTAGGAGGAAAAAGAATGCCACACACACGACCCCCCAGATGGCTTGATCGAAGGGATCATCGAACCGGA
GAGTATGGAAGCAGGTTTCGAGTAACCGAACGGACACTGGAGCCTTGTGTCGCGGAGGTGTGTCAAGCCGGCATATCCCTTTCAGAAGCATGCGAACGTG
TGGGTGTGCAATCGGAAGAACCCTTCCGGCCGCAGCGAAGAAGTGACGGACGCCTTGTAGCGTGTTGAGGATCGATGATCCGCGTAGCGGGCCGCCAGCA
CCAAATCCATATTGAAACCCGTGCACGATGAATTCAGAGAGTACGTGAATGCGGTCATCGTCGGTGACGCCCGAAAGCCATGGCTGAATTCCCCGACGCG
ATGTCCACGCCGTCCACTTTGTCATCGCAGCAGAGTACTTGGTGAAGGTGGAGTCGGCAACGGAATGCTCGCGGAGATATTGCGCCAGAGCACTGACAGT
CCGTGGACGTCTATCGTCGGTGATACCTGCGTCCAACCACGAGTTAGCTCTTTGAATTTGATGGCGTAAGACGGGTGAGCGGCGATGCGTGAACCGGCGT
CTGCGCGGGTGTTGTCGACCCCAGCGATATGGGAAGCCGAGAAACGGAGGTTGAGAGAGCTCTCCCAGTATCCCAGGAGCCTGATAATGTCTTGGGCACG
AGTGTTACGTGACGCGAGGCGATTTTGCCACGCCACCGCCGATGTATTGTCGATACGGAAGTGTATGTGGAGGGGGCGACGTCCGTCAGCAGCACACTCG
GACCACCGCGGACCCCATTCGTGGGTAGCGAATGCGCAGGAGAGCAATTCCCGGAAATTGATATTAAAACCATTGGCTTCCCCGGTCTTGAAGCGCTCAA
TAAGCCGGAGCTCATGGGATGAAAACCGGTAAGTCAGCGCAATTTTGGTCTTCGTATCGAGGGCACACAGTCCGTGGTCGCATGCGTCCATCTCGACGAC
CACGTCGGGCTCCGGGAGACTGTTAAAGTACTCAAGGGCGACGCCATTCAGGAGCGGGGAGTGAAGAATCTGCCACCACCAGAGCAGATCTTGTTTCATG
GAGTCGCATACCGAAACATGTCGAAACCTGTGAAGGTTAATCTCCCGAAGCCGTAGGCGCTGGAGAAATGGGCGCGCTGCCCTGATGCATGTTGCGACGT
GACGCAAGCCTCCCATGAGAGAGCGATACTGTTTCCGCGAGAGTACACTCGAGTGGTACGCCGATGCTACCAAGTTGCGAGCCTTAACGATCTTGACAGC
AGGCATCGCGACCGTTTCAGCAATGGTGTCGAATTGCAGTCCCAGGATCTTTTGACTGGTGTTCCATGCCGTGAATTTGTCCTCATTAACAGCCTCACTG
CCAAGTATAGCCGTCATAGCGTAGCGCAGTGAGCGTTCCATGTCTTCGCAGTTGGACCCGACATCAGCAGCGACGTTGACGTGGTCATCTACCCAGTGAT
AGTTGAAGAAACCATTCGGGTTGTGCTGGTTGGCATGCCCGCCGTGAACAAATGCTATCGCTCCACCAATGATTTCATATTCCCCAGGAGAACCCGTCCA
TCCAAATGGGCATGCAAGCTCAATGACGAGTGCATTCTCGATCTCAATGCGTCCTGCAAAGTGGTGAACGCTACGGCTGTGAATACTGACGTTTCGAAAT
GCGGAAGTCACATCGCCTGCCATGGCCTTGGTCTCAGCATCAGGGTGTTCCTTCTTGGTTCGTATTATCTCGGAAGCGACCGCATCACAGTGTCGATAGG
CGGCGCTTGGAATAGCGTCCTGGTCTGTGAAATCGTTGATCGAGGCGCCGTCAGGGAACGATAGATCATGAATTGTCCTTCCGGACGTCAGCGGGTCACC
ACCCGCCTTGTCGACTATCCCGAATGGGCTGACGAACACTTCTGGCCACAGCGAGAGGAGATCCAAGTCTAGTACAAGGCACCTCCATGCGTCTTGCTCC
TTGCGGACGTTCTTGCGCAGTATGTTCACCCTCTCAGTTGCCGATCCATGATTGTCCGGTGGATGCGATTGATGCGGCACGTCCTTCTTGAGCTCCACGC
GGACGCCTTCCGCTGCGATAGCTTGCAGTTTCTCTAAATGCTGGTAGTCCTTGCACACATGTGCGATCACTGCCGGAACCATTTGCTTGTTTGGACGGTA
ATCTGTTTCCGTCTGGCAGCGAACAAGTTCCGCTAGAGCCGGTAAAGGCATCTGTGTCCGGCGGACAAATTCGGAAAGCGTGCGTTGCAGTGGCTTGTTG
AGTAGGAACTCGGTGCCGCGTGACGATTGCCGGGATGTAGGATACGACGACGTTGGAAGCCGCAGCCCGACCTTCCCCAGAGCCTTGTTCAGTGATAGGC
GCCGTAGTGTTTCGAAGCCCGTAACGCGGCGGACTGCGTTTTCGGTCACCCGAGTTGCCCTTGTACAAGTTAATACATCGTGCATTCTGCGCGTTGTGCG
TTCAGCGAAGTCTACGCGTGGGTGCATATCTTCTTCCAAATGAGTCCGTTTCGACTACGCTAGGCAGTGAAGCCATCCCAGGTGCAGGAGCTGTCCTAGG
CTGTACAGCCATTTCGGATGCAGAAGCTGTCCTAGGCTGTATGGCCATCTCAGGTGACTGATGTGTCCTAGGCTGTATGGCCATCTTAGGTGCAGCTGAC
TGTATGGCCGTCCGAGTCGCCCTAGGCTGTATGGCCATGATAGGTACGGTTGCATGTGTAACCACTTGACGTTCAACATTCGCTGTGGTCGCAGGCTGAC
GTGGTAGATGCTGTAGCGTGGTCTCGCTAGTCAAAATTCGTTCGCGGCGGGAGCATGAAATTGAGCTTGAATTTGGCTTCAAATCTGGGTTTTCATAGGG
TGGAGTGCGTGTAATCCGCGAAATTTCCCGCGCCGAGCGCGAACGATCAGCCCCCACCCCACACCTCTTGCCTCCCGGCACGCCTTCTGCCCACGCAGCG
CCGATACACACACTTGACTCACTGGATAAACATGGGATGCTATAACATGTGTTATCTTCCTTATCCCAGTCTTCGCTCCGAAGTGGCGGAGAGTCGTCAC
CACCTCGGCTCCATCAGTTCCGTCCGTTGCGCCGCCCTTGCTTCGCTTCCTGGTCCCAGCCTCTGCGCCGCGCGTACGTGTCTTGGGCCCACTCCTTCAA
GCGCCGAGGAATGTCCGCGGATGGCCAGCCGTGGACGCGCTTCGGGTGTCCGCACCTGTCGCGGTTCCCGCCTGAGCACATAACGCCTCCGAGGAAGCGG
AGGCAAGGCTCCTCGCCGCGCCGGTTGCTCGGGATCAGAGCTCGGATCTCGTCCGGCACACTCTTCTCGCGCCGCCCTTGGGTTTCGCGGCTCCGTGGCT
GATCTCGCGCTTCGGGGTACCGGCTTGGTGGAGGGGCCGCAGATGCCTGCGAAAGCGTGTTGACCAGCGCCATGGTCCACTCCGACGACTTGTAGTCGAT
TGCAAGGATGGCCTTGCTGAAGCCACCCCACCAAGCCGGGCTGTCAACTTGAACGTGCCCGAGCGCTGTGCCGAGCCACTTGTTCACGTAGAGGAGGACG
AGCTTCACGCGACATGGCTGACCGGCGGGGTCTGCGGACTTGTTCTTCGAGACGAACACGCGGAGCCGCTCCGTGACCAGAAGCATGTGGTCATGCCACA
TCACCTCGCCCATCCTGGTCAGTCCGTGGATCCCGTCGAGGATGTCGTCGTACGCGCTGCAGCTGGTGGCCGCCGTCGGAAGAGTGGCCGCCGGGTTGAA
GTCCGACGCGAAGTTGCAGTTGGACGATCCGGCCTCCAGCGCTTCTTGTTCGTTCTCCTCACGGAAGTGAAGAATCGTCAGCCCTCGTGACCCAAGTCGA
CCGGAGAAAATCGCCATCAGCACGGCCGGACTTGTCTTGAACCCCACGCACTCCGCCTCACGCAAGCCTAGCACAAACGACATGGGAGACACGGGCTTAC
CTTCAGTCGGAGTGAGCCCCTTGAACATGCGAGTCGCCGCCAGCACGTGCGCTTGTGGAGGATGGTAGTCGCCCTTGGCCTTCTTCGCTTGTTCAGGAAA
ACTGGCGCT