Description :
From Genome Similarity Track
Location :
Scaffold_137:6913- 9107
Transcript NameFunction/comments
Hyaar_Emoy2810778ATPase family AAA domain-containing protein 2

Sequence
2194 bases(100 bases per row)
GTGTACCACCTGGAGCACTGACAATGCTGCAGACCCCAATAAATGAGGAGAAATGTGCACGTTGTATGCAGTTTGTACTGAAAAACTCTAACGACGTTAC
TGCATGTCAGCAAGCGACTGATAGTGAATGTCGAGCTTTACTGATGCGTCTAGGTCGAGTAAGTCCAGTGTCATAACCTTATTGCGAGCCCGAAGGGTGC
AGCTATTAGTGTTTGTGCGCAAGGTTGAATGCCGAACTTTTAAATCATACTTATGTGTGTGTCTGACTGTAAATAACGCGGTTAGGTGTACCTTACTCGT
ACTAAATACGATCTAGCCTGTCCCCACTCATAGGTCGATTAGCATGGTAGGTATCACTCTATGGCTAGGTCAATACTGTGATGCACGCATGTGATTGGCT
TAGAATCAATCAAAGGTGAATATGATCATGCAAGCAAATGCTGGACGCTCATAAGCAAAGGCTGTCGCGTTGCATGAGTGTATTTCTGGGTTAGTACAAA
CATTAACAGCATTATACTCCTTCTTCAGTGACTGCTGTTGTATAGTGTTTTGCAACTTGATACAGTTCTCCGAACTGGATTACTTATATTAAAGGGCGAG
CTCCAGAGCGCGCTCCTCTGTCTTATCGACAAAATAGATGATTCTCGACAACAATGCGCAGTATACGTACGCGCTATCGCTATTTTCTAGACGTGAAGGA
ACGATAACGTGACGATTACTCGACTCGAAGTATGTTTTTTTACTGAATGGGCCCACTTGTTGATTTAGACTAGGGATGTTAGGTAAAAAGTACGTGTTAA
TAACATTTTACTTTTTACCAGCGTTAATAACGTTAAAAACAAGACCACATTTTTGAGCAGACTTTTTACCAATAATTATTCATATCAGTCAAGGTTATTA
ATGGGAGGTTGCGCTGCAACCACATTCACTGTCCGTCGCCTACCCGTTACCGCCTAGCTCCAAAAAAGAAGGAAACTTGGCACGGGTAAGAACCATGCAT
GGCCTGTCATGTACGCAATCAGTCTTGAAGGCCTACTGTTCCTGCGAAAGACTTTATACATGCCTTCTCTGTAATGCTATTAATTATAACACATTCTTTT
CGATTCGCAGCTTTAAAATGCCCACCATCGGACGTCTTCATCTTCTGGTGTGGACGTTTACGAGAGGGTAAAAATAGCTGGGGGGAAGTCAAGGCCAAGT
GCAACTATTATTTACTTGGTTTGCAACCACAAGAATTTTGTATGGAGGTCCTCATTGCACAGGTATTCAGCGATGTACTGCTAATTATTTGCGATCTCTC
TGCTAACAGTATGACACATTCGTGCACAAAAAATGCTCCAATTGAGGCGAAGTTTAAGGCTGAGAATCTCTTCAGCAACCGGTCGGACAAAAAGTATTTG
ATGTGTGCATTGTGCATGCAGATCTCTTTTCTTCTATATAGTGACTAGCAAATTCCTCCTGGCACGGTTTTTCCATCGCATTTTGATGTTTTCTTGCGGT
CCGTCCACTTTACATAGTGAGAGTCTGCTTTATGGAGCTATAATAATACCTGTAATACTATTAAAAGCAGGGTGAAACGATATTTACTGGTAACAACATT
AAAAGTTGGCAAAACGTGGTTGTAAGTGGTAATAACGCTAAAAACTTGGTAAAAATGTTAATAACTGTTAGAAAGTCACGGAACTTTTTACCTAACATCC
CTGATTTAAACCGCTTCTATTATTGCTGGCGTCCTTACTATTCGCCTGTTTTAGCTCCACAAAAACAGGCAATCGCCCTTGTCCAATAGAATGCAGCCAC
CGCCCTCAGATGCAATAACCATGAGTCGCAGCGTGCTGGAACAAGCCGCGAGTCCAAGCACGAGCAGCGGTGCGTGTCGTCCCTCCTCCCGCTCCTCTCG
TTGACTAGTCCAGTCGCTCTATGCTCACTCTGCCAAGTCTGCTGTATTGATTTTGTGTGTGCGTGCGCGCAGACTCGTCGCCAGTGCTTGTAGCAGCTCC
AGAGCGCCAGCGATCGCGCTCTCTACCCGTCGAGACCGAGGAAGACGAGGTGGGGACGGCTGTCTATCGAGTATACATATAAATATACATGCATATGGTT
GTATAGTTGTATACGTCGACGTGGACTGATGTGTGAGTCCTCTTGTGTTTGGGTGTTTTTTTGCAGTCAAATGGAGGCGAGACGGACGAAGTGG