Description :
From Genome Similarity Track
Location :
Scaffold_469:69120- 70757
Sequence
1637 bases(100 bases per row)
ACCTGTTCATAGTGCGTTGTTGATTTATCTAATATGTACCGAGTGATCCCACTGTAGACTCCCCCCAAAAAAGAGAATATCTGCAGCTGTAGCACATGGA
ATGTACTGCACAAGCTACTGTAAGAAGAGGTACCCTCACAATCGTTGAGTTGAAATCATAACAGGAAGCCCATTGTCTAGAAAGTACAAGCATACCAATA
TTAAAAACTGTGTAGAGCTATTGTACATTCCGACCCTCGTCCACGAGCTCATCAAATGTCCTTATTTATCAGGCCCTTTCTACGATGCCTTACATTTTAA
AATGAATTGTCGAGTTTATAGTAGCTTACCATGTCGAGAGGTACTGATATTTGTTAGTTGAAATCTGTGACAAATTGACCATATACTGTAGATACAGGGA
GGATTAAAAGTAACTTGAGCTTTCGCCAAACTACTATATTAGAACAGTATTACCGTCCACAAAACTAATACTCGAGTACTATTACCGGGACGGGGAAAAA
GTAAAAGTAGTATTATTATAATACTGGACTATAAATGCCAATAAATGTAGACAATACTGTACTTAGTGAAATAGCCAAGCAAATTTGGCCCAATTAGAAT
AACGAGGACGACCAACTAAATAACCCAGGTCTAAGCTAAAACAGAGGAATGAAAAGCAGACAATCTCCTAATGTTAGTACCGGCTGTCCACACGACATCA
TGGATTCCTAACAAAAGACAGCATGACCACTCATTAGGCCTGACGCAACGGCTGGTGCTCGCCATGCAAGCTCATCAAGTGGTCCTATTACTAGCCACTC
AGGAGCTACCGTAATATAAATGACTATTATAGTAATAGTTTTTTTGGCAAACTGCTTGTACACCAAATCTTTCATACAATAGCTAGAACATATAATTCTA
GGCGAATTACTGCTAAATAGGTGGCACGGGAGCTATTAATAGTCATATTAACAATTTGGTTCCGAGCGTCGTAACTTGCGACATAGTCAATTAAATATGT
CGTAAGTTACGACATCCTGCTTAATATATTAGCAAATTGCTCGGAAGCGATTCACCAATACTTTAATCAAGTGTTTTGAAAGGTATAAGCTGCGAGAGGC
CTTTCAGAAACGAAACAAAACCAGGGCACGGGAAGGGGGTCAGATGGAAGTCGGGTACTTGTCGACTCATTCGAGAATTTGCTGCATGGCGTACAAGCGA
TCCAGTCGCCGGGACAAATCCTCCGCTCCGGCTTCGGCCGCACACGACGTAGACTTCTGACATCTATGGCTGCAACTCAAGGCAGTCGGGTGGAAGTCCA
AGCAGCCGACAGGACTACAGACACAGTGGACGTATACATTTCCTGAGGAATCTCGTGTGTTTGTAGGAGAGAGTGAAGTCCGTAGAGTACGACTTCCAGT
CAGGTTTGCTGGTTGAGGACGCTACGGAGGAAGGGTGTGGAGAGGCGCCGGGGGAGCCTGGACAAACCCAGGAGGATGCCGGGAACGATTAGGGGGGAGT
TCCGTGTGCTGAAGAAGTGATGGGGGAGGGCATTACGCCCTTCCCAAGTCAACACAAGGGTGCAAAGTAGGGCAGGAAGATATCCAAGAAAATAGTACAG
ACCCCTGCGACGAGGCTCGAAGAGCAGGATAACAGCG