Description :
From Genome Similarity Track
Location :
scaffold_1783:691- 2803
Transcript NameFunction/comments
Pl_100342hypothetical protein PHYSODRAFT_522638

Sequence
2112 bases(100 bases per row)
CTCAAACGTGTTTAAGGTGGGTGACTTAGTCTTACTCGACACTAGAAACCTACCTCTAAACTTGGTTAGCTCCATGGGGAGCAACAAACTGAAGCACCTC
TTCATCGGACCCTTCGCGGTCCTGAGTAGACACGGCGCTGCCTACACAATCGACTTACCTAAGTCGATGACACCCACCCGACGTTTTATGTGGGTCGCCT
GAAGCGGTACCATGACCCGCAGGGTCAGAGTGCACCGTCGGCAGTGATGGTCGACCACGTGCCGATGAGTCAACCTCTTCAACCCGAGGTTGGCTGTGAA
GAGCCACGAGCTCAGTCGACGGTGGCGGTTGCGAGTATTGACGACTATCATAAGCAAACACGAAAGGCTACTGGGCGTACGACGGATGTACGACTCGTAC
GTCGCGTATGAACCATACGAATGGGAGTACGCAAAAGGTTGCGACTCCACGAACGAGGGCTGATGAGCCACTCGGTACAGGACCCGGTGCTCCAGGTCCT
CAGGGTCAGCCTTTGTCGCACGGCGACCAACGGACAGATAGAGCCCTCGGACCTCGCGGTCCAGTGACTCCAAGTCCTCGCACAAACGAGGGCCAAGTTC
TGGTTGGCCAGACTGCGAAGTAGCGTCACCACCAAGGCCTACACCAGTGACACACTCCACCGCGTACAAGCACTCAGGGAGTTGGCGGATCTCCTCCTCC
ATCTGAGCTAGTGGCCGGTCTCGAGGATCAGCCGTATCCTCCAGAGCCACCTTTGAGGGAGGTGTCTCATACGAGTAGTCGAGAGCGGCCACCGCTGGCC
CTCCTCGACCGGAATAGAGAAATCCACTACTACATGGAGCGTATCCTCCAGGAGCGGCGCTTCCACGGGAAGCGCGAGCTGAAAGTGAAGTGGCGGGGCT
ACCCGACTTCACAGAGCTCATGGGAGCCCATCGTGCAGCTCCAAGTGAACTACCCGAAGACTATCTCGATATAGGTGGAGGACTGGGTGCTTCTCTTTAA
CCCTGTCGTCCGAGGGATGAGTTGCCGCCTCGCGACGAGATAGGCGAACTGAACCCGAAGGTTCCGCTGGGGCAAGATGAAATCCAGCTCAGCTTCAGCC
TGGAGCTCCTTGATGGGATAACCCTTGAGGGCGACTCACCTCCAGAACAAGGCTTCGACCTGTGCAGCCGTGGAGGTGTTCTCCGGCTGCACCCATCGGA
ACCCTACACGGGGTAGAGGACACCTTTTTTCTCAGGCATCTAACGAGGGCTAGTGAATTCCTTCAGTGGAATTCTGTTTGGTGTAAGAAGCACGCACCTG
GCGGCCACTATGTTTTTAATGTACAGAGGCACGTCTTGTACAAGATGGTGCTCGTACGGGGGTCAGTGAGCTGCTCGAGAAACAGCTGAGAGCCTGTGCC
CTCATCGGGTGGATAATATCCGGGAGCACGAGCCGTAACCCAGTGCTCAGCGTGAGTAGACCCACAAGTAAGTGAGAGTCTAGCTACATGAGCAGCAAGC
AATGCTTCTGGCTGCTCGTCGAGGTTGTTCGTAACTTCTGGCGGTCCTTCGACTTCTCTTTCCTTTTCGAACCTGGAGTCGATATGACCGCCCCCACACT
TGGGCAGGCCCCTGCGATGGGTGCAATGTCCATCGACCTCACCAAGGTCGTGGTCGTTCATGTGGAATAACAGTGAGGCACTGTGCTCCTTGGCGCTAGC
CTCTATGGCGCACCCGTCGCCAAGGGCGTTGCTGTCACGTACAGAAGAGGCACCCACGTTCGAATTGTCGGTTGCAGACTTCGATGAGGCGTTCTGGTCC
TCATCCTCGTCGCCAGAATATACGACAATGGTCTCGTCAGTCAAACTGACTGGAGACCTGCTCCTGAACCCGAGAAGCAACGCTGGGTTCTCGTCATGGT
CAGTTGATAACGACGGATACTGTCTGCGAGAGGAACTAGAGCTTTCTGCCGCTTCAGGTGCACGGTGCACCTTATTTGCATCCGCAAGTGCATCGTAAGA
TGCCTTAGTTTTGCCGCGAGGCTTAGCTAGGTTGGACTTTTGTTTTGCAACCTCAGTCGTGATGGTACAGAGACCCCACTTGAGATTCCCCTTCGAGGCA
TGCTCTCGGGTC