Description :
From Genome Similarity Track
Location :
Scaffold_314:691- 1932
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G015112Similar to JLP1: Alpha-ketoglutarate-dependent sulfonate dioxygenase (Saccharomyces cerevisiae)

Sequence
1241 bases(100 bases per row)
GGGATCTCGCCATGTGTCGTCACTCGGACTGCGTGGCGGTTGCCAGGGAGGTAGTCAAAGGTCGCGTAGTGCGCAGTCACGCGGTTGTCCCAGATCGCGA
CGGCGTTCTTTGTCCAGCGAAAGCGGACTTGGAACTCGTGACCCTGTGCAATGTGCTTGTACAGGAATCTCAGAATTGCATCTAAATAGTCAAAGAAAAA
TCGGGATCCACTTAGCATTTCACGAAGCTTTAATGTCTGCGCAAAGAGCAATTACGTACCAGATTCAGCGACAGACAATTGCGGGATGCGAGTGACAAAT
CCAGCATTGACGTAGAGAGCTTTGCGTCCGGTGGCTGGATTCGTTCGGACAATGGGATGCTCAAACTCGACAGCAGGACGCCGCACAGTGTGCCCACGCG
CTACGGCTCGCTCCGCTTGGCTCTATACATATAAGCGACAATTAGATTCTGCCTTTTGAGCCAAAATTCACTACGATAATCGACATCTTTTGTACCTTGC
TGCTGTGAATCGCCGTGAGTCCTTCGAGAAGAGCTTTCATCGGTGGCGTCAAGCGCTCATAGGCTTCGTAGCCCGAGGCCCACAATGTATCGCCTCCCAC
GGATGGGTTCGTCAACAATTTGAAGCTCGTGTACGATGGAGGCTACAGTACCAAATCGATACACACATGCAAAGTTAGGTATTGGGCAAATTCAACGATG
CTGGTAGCTCTTTGCTTTCTCACCTGTCGTTCGTTTGACACGTCACTGTGCCACTCGTTTGCAGGAACGTATTGCTGGTTTTTGAGCAGAGCCGCGCTTT
TCGCAAGCGAGTTCTCGACCACAACCACCTCTGGGTGGCCCTCCGGGTGGCCCAAGTTCTGGTGAATGTGGAGAGGACCGTAGTATCGGCCCAAATCCAA
TTGCTGATCAATCGTGATGTCTTGGTCGCGGAAGAACACAACACCACGGTGCGCAATGAGGAGCGCCAACTCGTCCTTCTGCGCGTCCGTGAGCTCATGG
AGCTGGATGCCCGAGAGCTCCGTGCCGATCTTTGGTGCGAGGTGCGTCACCGTGACATCTCCCGCGAGCAGGTTCTTGAAAGTCGGATCGGCCTTTAGTG
CACGGTCCTCGTACGGTAGCACGGGGATCGGGTCGTACTTGGTGTCTGGATACACGCTCAGAAGCTCTGGGTGCTCAACTCGCGTGCACAGGTCTTCGTT
GAGCGCGTTCTTGATGGCCACAGGGCCTTGCTGCTGTCTGC