Description :
From Genome Similarity Track
Location :
contig_23:690431- 695134
Transcript NameFunction/comments
g5227.t1hypothetical protein PHYSODRAFT_321620

Sequence
4703 bases(100 bases per row)
ATCCAAAAAGGGACGAGGGGAGCGGAGCCCCCATTGTAGGTCATGCAGCATATGCCCACTAGTGAAGAGTTGAATCATCCTTGGAGCCGGTGACCATGTT
AGCAGCGAGGGAAGTGACGGATTCCGCGCAGAGGTTGGTGTAGGTCTTGAAGGTGTCTGAAACCCACCGGCCGTGAAATTGAATCGTCATGGCATTCACT
CCTGCCCGATACATGTGCGTTGCACCCCTGCACGGAAGGAGTGCGGGCTGAAGTTCCTTGGATCCTCACCATTCAGTACAGCGGCCTTCTTGATCGCGCT
CGACAGGTGTGCCGTTGAAATGCACGCCGGATGCCCGGTGCGTCCCAGGTACATTGCCACTGGTAAACCGGGAGGGAGGTCTTGTCTTGATCGTAGAAGG
AGAAGAGCACCGAAGACAGGGCACAGGAATGCGTGGCCTGAACGATACAGCATTCTAGCTGTTGCATGTCCGCACTGATTGGTCTTGGAACCGCGAAGCC
GCATGTGTACCGATTGCGCTTCAGTCGCCGATAGTGTCGGTTCCCCCGCCATGTCCAGGACAACCAGGTCCTCAGCTCTAAGCACGAACCACTTGAACGA
GTTTCCGCTGATGGAGACAATTTCCGAGCGTCTAGGAGGAAAAAGAATGCCACACACACGACCCCCCAGATGGCTTGATCGAAGGGATCATCGAACCGGA
GAGTATGGAAGCAGGTTTCGAGTAACCGAACGGACACTGGAGCCTTGTGTCGCGGAGGTGTGTCAAGCCGGCATATCCCTTTCAGAAGCATGCGAACGTG
TGGGTGTGCAATCGGAAGAACCCTTCCGGCCGCAGCGAAGAAGTGACGGACGCCTTGTAGCGTGTTGAGGATCGATGATCCGCGTAGCGGGCCGCCAGCA
CCAAATCCATATTGAAACCCGTGCACGATGAATTCAGAGAGTACGTGAATGCGGTCATCGTCGGTGACGCCCGAAAGCCATGGCTGAATTCCCCGACGCG
ATGTCCACGCCGTCCACTTTGTCATCGCAGCAGAGTACTTGGTGAAGGTGGAGTCGGCAACGGAATGCTCGCGGAGATATTGCGCCAGAGCACTGACAGT
CCGTGGACGTCTATCGTCGGTGATACCTGCGTCCAACCACGAGTTAGCTCTTTGAATTTGATGGCGTAAGACGGGTGAGCGGCGATGCGTGAACCGGCGT
CTGCGCGGGTGTTGTCGACCCCAGCGATATGGGAAGCCGAGAAACGGAGGTTGAGAGAGCTCTCCCAGTATCCCAGGAGCCTGATAATGTCTTGGGCACG
AGTGTTACGTGACGCGAGGCGATTTTGCCACGCCACCGCCGATGTATTGTCGATACGGAAGTGTATGTGGAGGGGGCGACGTCCGTCAGCAGCACACTCG
GACCACCGCGGACCCCATTCGTGGGTAGCGAATGCGCAGGAGAGCAATTCCCGGAAATTGATATTAAAACCATTGGCTTCCCCGGTCTTGAAGCGCTCAA
TAAGCCGGAGCTCATGGGATGAAAACCGGTAAGTCAGCGCAATTTTGGTCTTCGTATCGAGGGCACACAGTCCGTGGTCGCATGCGTCCATCTCGACGAC
CACGTCGGGCTCCGGGAGACTGTTAAAGTACTCAAGGGCGACGCCATTCAGGAGCGGGGAGTGAAGAATCTGCCACCACCAGAGCAGATCTTGTTTCATG
GAGTCGCATACCGAAACATGTCGAAACCTGTGAAGGTTAATCTCCCGAAGCCGTAGGCGCTGGAGAAATGGGCGCGCTGCCCTGATGCATGTTGCGACGT
GACGCAAGCCTCCCATGAGAGAGCGATACTGTTTCCGCGAGAGTACACTCGAGTGGTACGCCGATGCTACCAAGTTGCGAGCCTTAACGATCTTGACAGC
AGGCATCGCGACCGTTTCAGCAATGGTGTCGAATTGCAGTCCCAGGATCTTTTGACTGGTGTTCCATGCCGTGAATTTGTCCTCATTAACAGCCTCACTG
CCAAGTATAGCCGTCATAGCGTAGCGCAGTGAGCGTTCCATGTCTTCGCAGTTGGACCCGACATCAGCAGCGACGTTGACGTGGTCATCTACCCAGTGAT
AGTTGAAGAAACCATTCGGGTTGTGCTGGTTGGCATGCCCGCCGTGAACAAATGCTATCGCTCCACCAATGATTTCATATTCCCCAGGAGAACCCGTCCA
TCCAAATGGGCATGCAAGCTCAATGACGAGTGCATTCTCGATCTCAATGCGTCCTGCAAAGTGGTGAACGCTACGGCTGTGAATACTGACGTTTCGAAAT
GCGGAAGTCACATCGCCTGCCATGGCCTTGGTCTCAGCATCAGGGTGTTCCCTCTTGGTTCGTATTATCTCGGAAGCGACCGCATCACAGTGTCGATAGG
CGGCGCTTGGAATAGCGTCCTGGTCTGTGAAATCGTTGATCGAGGCGCCGTCAGGGAACGATAGATCATGAATTGTCCTTCCGGACGTCAGCGGGTCACC
ACCCGCCTTGTCGACTATCCCGAATGGGCTGACGAACACTTCTGGCCACAGCGAGAGGAGATCCAAGTCTAGTACAAGGCACCTCCATGCGTCTTGCTCC
TTGCGGACGTTCTTGCGCAGTATGTTCACCCTCTCAGTTGCCGATCCATGATTGTCCGGTGGATGCGATTGATGCGGCACGTCCTTCTTGAGCTCCACGC
GGACGCCTTCCGCTGCGATAGCTTGCAGTTTCTCTAAATGCTGGTAGTCCTTGCACACATGTGCGATCACTGCCGGAACCATTTGCTTGTTTGGACGGTA
ATCTGTTTCCGTCTGGCAGCGAACAAGTTCCGCTAGAGCCGGTAAAGGCATCTGTGTCCGGCGGACAAATTCGGAAAGCGTGCGTTGCAGTGGCTTGTTG
AGTAGGAACTCGGTGCCGCGTGACGATTGCCGGGATGTAGGATACGACGACGTTGGAAGCCGCAGCCCGACCTTCCCCAGAGCCTTGTTCAGTGATAGGC
GCCGTAGTGTTTCGAAGCCCGTAACGCGGCGGACTGCGTTTTCGGTCACCCGAGTTGCCCTTGTACAAGTTAATACATCGTGCATTTTGCGCGTTGCGCG
TTCAGCGAAGTCTACGCGTGGGTGCATATCTTCTTCCATGAGTCCGTTTCGACTACGCTAGGCAGTGAAGCCATCCCAGGTGCAGGAGCTGTCCTAGGCT
GTATAGCCATTTCAGATGCAGAAGCTGTCCTAGGCTGTATGGCCATCTCAGGTGACTGATGTGTCCTAGGCTGTATGGCCATCTTAGGTGCAGCTGCTGT
ATGGCCGTCCGAGTCGCCCTAGGCTGTATGGCCATGATAGGTACGGTTGCATGTGTAACCACTTGACGTTCAACATTCGCTGTGGTCGCAGGCTGACGTG
GTAGATGCTGTAGCGTGGTCTCGCTAGTCAAAATTCGTTCGCGGCGGGAGCATGAAATTGAGCTTGAATTTGGCTTCAAATCGGGTTTTCATAGGGTGGA
GTGCGTGTAATCCGCGAAATTTCCCGCGCCGAGCGCGAACGATCAGCCCCCACCCACCCTCTTGCCTCCCGGCACGCCTTCTGCCCACGCAGCGCCGATA
CACACACTTGACTCACTGGATAAACATGGGATGCTATAACATGTGTTATCTTCCTTATCCCAGTCTTCGCTCCGAAGTGGCGGAGAGTCGTCACCACCTC
GGCTCCATCAGTTCCGTCCGTTGCGCCGCCCTTGCTTCGCTTCCTGGTCCCAGCCTCTGCGCCGCGCGTACGTGTCTTGGGCCCACTCCTTCAAGCGCCG
AGGAATGTCCGCGGATGGCCAGCCGTGGACGCGCTTCGGGTGTCCGCACCTGTCGCGGTTCCCGCCTGAGCACATAACGCCTCCGAGGAAGCGGAGGCAA
GGCTCCTCGCCGCGCCGGTTGCTCGGGATCAGAGCTCGGATCTCGTCCGGCACACTCTTCTCGCGCCGCCCTTGGGTTTCGCGGCTCCGTGGCTGATCTC
GCGCTTCGGGGTACCGGCTTGGTGGAGGGGCCGCAGATGCCTGCGAAAGCGTGTTGACCAGCGCCATGGTCCACTCCGACGACTTGTAGTCGATTGCAAG
GATGGCCTTGCTGAAGCCACCCCACCAAGCCGGGCTGTCAACTTGAACGTGCCCGAGCGCTGTGCCGAGCCACTTGTTCACGTAGAGGAGGACGAGCTTC
ACGCGACATGGCTGACCGGCGGGGTCTGCGGACTTGTTCTTCGAGACGAACACGCGGAGCCGCTCCGTGACCAGAAGCATGTGGTCATGCCACATCACCT
CGCCCATCCTGGTCAGTCCGTGGATCCCGTCGAGGATGTCGTCGTACGCGCTGCAGCTGGTGGCCGCCGTCGGAAGAGTGGCCGCCGGGTTGAAGTCCGA
CGCGAAGTTGCAGTTGGACGATCCGGCCTCCAGCGCTTCTTGTTCGTTCTCCTCACGGAAGTGAAGAATCGTCAGCCCTCGTGACCCAAGTCGACCGGAG
AAAATCGCCATCAGCACGGCCGGACTTGTCTTGAACCCCACGCACTCCGCCTCACGCAAGCCTAGCACAAACGACATGGGAGACACGGGCTTACCTTCAG
TCGGAGTGAGCCCCTTGAACATGCGAGTCGCCGCCAGCACGTGCGCTTGTGGAGGATGGTAGTCGCCCTTGGCCTTCTTCGCTTGTTCAGGAAAACTGGC
GCT