Description :
From Genome Similarity Track
Location :
Scaffold_730:6900- 8364
Sequence
1464 bases(100 bases per row)
CTTTCAAGATCCCGTCACAGGAGGCGGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGTTTGCGTCCGCGCGGCATCTGACCACTCGGTGGTTGCCTTGTCACGTTGGAGCTCGGTGTCCGTCA
CCTTGTCTTGGAGTTCGTCACGGGCTTGAGTCATACGCACGAATTCCTCAAGCGCGTAATCTCGCCCAGCCGACAACTTCTCAATCGACTCTTGTGCATC
CTTCAGCTCATCAGATAGACGAAATAGGGCGATGTTTGGTGACGAAGAAAATGGATTCGGCGCAGGAGACCCTCCGCGAGCTGACCCTAATGCAGATTCA
CCTTCGGCGGATCCCACATAGTTGTTGATCACCACATCTTCCTGAGGCAGACGCAACGCGTCGCGGAGCCGATCGAAACCATCGTCGGCAGCCACGCTAG
GGACTTGAGCACCTTCAAGATCTCGCTCCAGATCATGGATCTGCGATTGGAGTTGATGGATCTCGGACCCGGCCAGCGCCATCTCCCGAAGGAGATGGTC
GTTGTTGTGGTGTAGTGATTTCTCCGTAGTTGCGGATTATCACCCGTCGACAAAGACGTGACACCGCCCAAGTTGTTCAAGCGACGAACCCTCGGTCAGG
TGATGTACGGAGACGCCAAGGTGCAAGGGACTCGACGGCGTCACCTCCGAGCGTTCAACGAGTATTGGATACGGGCATATGTCACTGAATCCAGGCTGTC
CTTATTATTAATAATGGACTGGCCGGATTCGCATTCAGCGGACCATCTACGGTACGAACTCTCAGTGGCGGTTGGGATGAGTTCGCGGAATACTCAGCGA
CCTTTGGAAGACACGTTCACCGTCTGGGACAGGGCGCGGACCGTTAAAGATGCTCATGCGACAGTGCAGACGACGCTTGGCATGCAAGAAGATCCATAAC
GGATCATTGTTCACTTGATATTTGTATCTTGATTAGGACTTCTTATTAGGAATAGACCCGAAAGGGTAAGCTTAAATACAGAACAGAATTTCCACTCAAG
CACACAGAGCGACGTCCGGCTTCAAGGTAAGCGTCTGGTCAAGCTTGTTTGAGTGTGTTATGCCTGTCGGCGAACTCGAAGCTCTGTAGCGAGAATTCAT
CCGGCAAGGCCAAGAGACTGTGTGTGTATTGGCCGATTACTATCGGGAGGTTTTACGTGACGGCTTATTGCTGCCTATTTGCACGACTGGGATTGCTTAT
ATTGCATCCTTTTTATATTTTTAACCGAGTGTTGAACACTCGGTGCCCTCGTAAAAGGCTTACCCGTGCCTGGTACTTGGGACTACGAGTATTTATAACA
CCGGATAGCTTTGCTCGTGCTAGTAGCGTGTTCTTATTTTTACTGGTTGGCCTATATAAGTAGT