Description :
From Genome Similarity Track
Location :
Scaffold_2339:690- 1865
Sequence
1175 bases(100 bases per row)
TTCGCTTTATAAATCGACGGATATAACGTTACACTTGGCCAACATCAACAGCAAACACTCTGTTAAAACACACAGCGACCTATTTTTTTCGTATGTCGAC
AGTCCAGTCGTATAGTCTAATTGTACAAGCAAACATTGTGTAAATAAATGTCAGCAAGAAAAATTAATACATGCCTCTTCTCAAGAACCGAATAACGAAT
GCTAAGTCCGGCACGAGTCAACGGGCTCACAAAGCACTTGTTCGGTGACTTCTGAACAGCTTCTTCTTGGCTTGTACGCTGCTTCTTCCATCGGTACAAT
GTCGATCGATGAACATGAAGTGCTTGTGCTGTCGCTAGTCACAGTCACATATTCTGCTTCGCTGAGATACTCGATTGCCTAGGCGACAATTATAAATATT
ATATAATAGTAATAGGAAATTAAGTTTGTGTACCTGAAGCTTCTTGCTATGGCTGGTTTTAGGTCTTTGTGGTATATTTGCACGCGAAAAGTAAAATGTT
ATGGATCATATCTCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGATTTGTTTACCGGATACGTGATAGCCAAAGCTAGTG
CGTCTAGAACTGCGCAAACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTT
TATGTCTGATTTCTTTCGAGCATTCAACCAGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGATCGGCCGAGCGCATG
GTGCAGACAATCACGAGAGCCTCAGAGATTATTTTCCCAGGTTTTTGTTCCAGAAGATTTGGAGGGAGTATTCCGCAGAGCGTCTTCTCCTTCGCAATGA
ACACCGCCCAAGACAGGATCCGGGGTGATACACCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTGGAAGCGGCCATCCCAGTTTGCAGCAC
CAAGAAGAGGAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATA
CAGGATCGAGCGGATCGACACAACGAAGATGCCCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTAT