Description :
From Genome Similarity Track
Location :
Scaffold_63:690- 1711
Sequence
1021 bases(100 bases per row)
AATATGCAATTGACTACGTATAGTGTTCATACATGACACATATTAATGTGTCCTGAACTGTAGATAATGGGTGGGTTTGGAAGAGGCGGTAGAACCCGTG
TGGGTGGCAACCCACACTCCCCTGACTTGAGAACCCATGTAATGGGTAACCCCATTACACACGTTGCATCGCTTCATTAAGTTCGTCAACGGCTTCAACC
TTGTACTGGTTGTTAAACTTGAGTGAGATGCGGTCTCATGATATCTTGTTGCGTTTCGATGCAAGCTGGAAATGAGCGGAAGGGTGATGTGGATCGGCAC
TTAGTGGCGGGTGGCAGGAAGAGCTCATGCGTACTCCCCCTAGTTTTGGTAATATTCTCGTACCTCACCGTATTTTGACAAATTCTAAATTTAATTTTAG
CCAATCAGAGTGAATAGCGCTAGATACGTTCCAGCAGGAGTGTTTTCCAAAAACCCAATACAAACGACTGATTTGGGTGGTCCCATCTAATCGAACTTTG
CGGTGCGTCACAACATATCTTGCTTATAATCTAACAAAACAGGCTTAGTATAATAATTAGTTTATAACTATGCATAGTTAATGTAATTTCCAGTATTCTA
TGTACTATACTAAAGAACATATTTTGTTTTAACCAAATACTCCGGACTTCGATTTTGTCTAGTAATCGTATCTAATACAGTCGTGCAGCAGACTTTGGTG
AAGACTCTGGATAGAATCCAGAAAATAAACTATATATCTTTGCGTGCATGCACATAAACTTCCCAACAAACACGACAAGCAGGACAAGTAACCAGACGAG
CACTCCACAACCAACCCAAAGCACAAGATAAACAGGACAAACAGACAGATAAACAAAGAAAAAATTAGACAGGCAGATATTTGAAACCGGACACACACTT
GAACACTCAAGACATACAGAGCAAACAGGACGACCAGGCGCATTCGAGTCAAAACCCAACAAAAACTTTTTTCGAGACGCTCCTCCACCCTCCTTGCTCG
CCCACTCGTGCTTCGTAAAGA