Description :
From Genome Similarity Track
Location :
Scaffold_1519:69- 5473
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1519-fgenesh-gene-0.0Fumarylacetoacetate hydrolase
Pytar_ATCC12531maker-par_contig_1519-snap-gene-0.6Vacuolar protein
Pytar_ATCC12531fgenesh_masked-par_contig_1519-abinit-gene-0.15Conserved hypothetical protein

Sequence
5404 bases(100 bases per row)
GCAAGAAGATTGTCGCGATCGGCAAGAACTACGAGGCCCACGCGCGTGAGATGGGCGCCACGAGTGCGCCGAAAGAGCCCGTGCTGTTCCTCAAGCCTAC
GACGAGCTACGTGGCCAATGGCGGCGACGTGCTGCTTCCGCCAGGCATTGGCGACGTCCACCACGAAGTGGAGCTGGGTGTCGTGATCGGCAAGAGCGGC
CGTGACATCAGGCAGAGTGAGAGCATGGACCACGTTGCGGGGTACGTGCTGGCGATCGATATGACGGCGCGCCACCTGCAGGACAAGGCCAAGAAGGCCG
GCTTGCCGTGGAGTCAGGCCAAGGGCTTCGACACGTTCACGCCCATTAGCGACTTCATCCCCAAGAGCAGCGTGCCGGACCCGGACAACCTCACGCTCTG
GCTCAAGATTGACGACGAACTGCGTCAGCGCGGCTCGACAAGCGACATGGTCCACAAGATCCCGTTCCTCATCTCGTACATCAGCCGCATCATGACGCTC
GAAGAAGGAGACGTGATCATCACTGGCACGCCCGAGGGCGTCGGCCCCGTGCCGCCTAACACGGTACGTCTATGCTTGTCTTATTCTCATTGGGTGATTT
TTGCTAGTCGAGATATCTTATCCTGTTGGATCTGATGGTGTAGACCATGAGCGCCGGCATTGACGGTCTCATCGACATTTCGTTCCCGGTCAAGACACGC
GTCTACAAAGACTAGAGAATGAGAGAAGGAAACCAGTCGGAGAATGGATATTCTACTGTACTGTCACGTTGGGCCTGTGGCGAAGCGTTCCATGACCGCG
ACCACGGCCTGGTCCGCGCGGATCTTGCGCAGCGACGCCATCTTGTGCACGCGGCGCTTGCGTGTCATGATGGTCCGCGCATGCTGCACGCGCACGCACC
AGCCGCGATAGATGGACTGGATGCACAGCGCGGCGGCATCGTGTCGTAGATTGCGAACCGCCGTCGTGGCGTTCGCGTGGACCTCTTGAGACGTACTCGG
CGCCTTGAGGAACTGGAGTAGCGTGCCCAGCACGCCACTCTCGACAAGCTTGTTACGAGCGACGTGGACCATGGACATGGCAGCAATCGCGCGGGTCGCT
TCCACGAGCACGTCGCTCGTGCGTGAGATCGGACACACGTACTTGACGAGAATGGTGAGCATACCCTCGTCAATGAGCTTAAGAATGTTCTCGGGCCGCT
CAGCAAAGTTGGCAATGATGCGCGCAATGTTGGTGCGCGTCTGGATGAGCGGGTGAAACGCAAACTCTTGCAGAGCCCGCAGCAGCGGCGGCTTGCACAT
GGTGAGGCGCGAGTTGGTGTCCTCGGTGAGCTGCGCGATCGCCGCGATGGCGTCGACCTTCATGCTGAAGTCGTTCCCACAGAGAATGCCGAAGAGACAC
TTGATGATGCCGCGTGCCAGCAGTTCAATGTAGTGCTTGAAGTCGGCCTCGGTCAGGGGACAGTTCCGGTTCTCGGGGATTGGCGGTGGCGTAGGCCGAC
GGTCTCGGTCGCGTTCTCGTTCTCGGCAGACGAGGAGAGCGAGCAGCGTGATGACCGACCGCCGCACGCGCTTGTCGGAGGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGTACAAATTGCGCGCCGCGATGTAGTCGACGAGCTTAGAGCGGATGATGTGGTCTCGGTTCACGGGGTTCTTG
GCCAGCTCACAGAAGACCGTGAAGGCCGGTCGCAGCAGTGCATTTACCTCCGACGAGATCACAACTGGTAGTTGCTGGGAAGCAGCCATGGACCTGTTGG
CAGTGGCTGTGGGTGCCCCACTCTCTGTCGGTTTTGCCGTGGACACCATCGGAAGGAGCGACACCATCTCGCCCATTGCAACTCGTGTGGTGGAAGAGGA
CTCTGCCCTAGCCGTTGCACTCTGTGGTCGCCGCTGACTGTGTGTCAGTGGTCGCCGCTCCACTACTGTCGAGGGAAGTCCTCGTGGAGTGCAAAAGCNN
NNNNNNNNTCGCGGTTGGACGAAACAGCCTCGAGAATCGCCACAACGAGCACGCAGATGGCGTGGGTCGCCTNNNNNNNNNNCATGGGAAGCAATGGCAC
CATCTCACCCATTGCAACTCGCGTGGTGGAAGAGGACTCTGCCCTAGCCGTTGCACTCTGTGGTCGCCGCTGACTGTGTGCCAGTGGTCGTCTCTCCACT
ACTGTCGAAGGGAGTCCTCGTGGAGTGCAAAAGCACAAGTGCACAATCTTGGGCAGCGCGTTGGCTTCGACGATGGCCGCGTGGTTCGTGCGGTTGGACG
AAACAGCCTCAAGAACTGCCACGACGAGGACGCAGATGGCGTGGGTCGCCTTGGGCGAGTCCAGAATGAGCAAGAGCGTCGGCACCAAGCGGAGCTCGAC
GAACTTGCGGCCGTTTTCCTCTTCGGCCACGAGCAAGTGGATAAACGCCAAGAGTTCTCGTCGAAAGTGCGCGTCCCGCTCGATGAACGGGTCCTGAAGT
ATGGCGGCAAGCGTCTCGAAATGGGACGAGTGGTAAAAGAGATAGCGGCTCTCCGAGGACGCAGCGAGCTGGTGGAGAATCGCGGCGGCCAGCAGCCGTA
TCCGCGAGTCCTTGGACGAGCAGCACTCGAGCATGTAGGCGAAGCCCTCTCGCCTGGCCACGGCCTGGCGCATGTCCTCGGTCGTCACCAGATTCTTCAC
GAGCTCGAACGCGGTCCGGCGTAGTCGTAAGTCGTAGGAATGGAGTAGACCAAACACGCACTCGAGTCCGCCGGGCGCCTGTAAGACCTTTAGTTTGACT
GCGTCCAGCCTAGCCATGTTCACGAGCGTTTGAGCACAGTCAAAGGCGATCGCTGAGTCGGTCTTACTCTCCCCGGCACTGAGCATGGAGATGAGCGCAC
CCAGCGTCCCGACTTCGGAGAGCAGCTCCAAATTGGCCGCTGAAAAAACAACGCAATCGGTCAATGGATCAACTAGAAGCAGAGAGTGGATCGCTCGGGA
CGTACGGTTCCGGCTGAGCGAGGCAAGCGCGGCTGCGGCGTCGCGCCGCACTTCGGGGAAGGGGGACCAGTACGCGATGTCGATGAGCGGACGCACATTG
TCGGCGTCCACGTCGCGCTTCTTGAGCGTCTGTCTCACTTGCGCACTGCGCACTGCGTCCCGTCTCGTGGCCACGGCGACTTCGAGCTGCTGGTCGAGCG
TGAGTTGTTTCCTTCGATCGGTCCGCTCAAGTGCGGATTCCTGGTCAGCCTGGTCGCTGGTTGCCTTGTGGAGCCGCGTCCACGTGACTTGAGAGAGCCG
CTTGGGCGAGCCCCGAGCGATCGCGTCGAGCTGCGCCTCTCGAAACACCGATGCGCGGCGCACTGGGCTGTTGTCGTCGTCGGCGAGCGATGGCGGCAGC
TTGGTCGTGAGGCGACGGGCCGAGGTCACGGGTGAAACAACAACTGGCGGTGTTCGTGCACTGCTGTCGTTGGGAGGAATGGTGCCATTCTCTCTGGGGC
CATTGGAGTGCGAATCAACATGCGCTGTCCGTGCTGCTGACGTCGGACGCCGCGTCGGTGGCTTGCGTGGCTCTGGGGGGAAGAGATCCGGAGGTGGCGC
GTTCCATTGGCGGCGCGCGACTCGACCAGGTGCCGCCGCTGAGAGAGGGCGCGACGTCAGCGCAGCGGGCGTTTGTGGTTCTCTTGGTGGCGGAGCGACC
GTGCCGATTGTCGGCATTGGCAACTAGGGAGATGGGATTCGTCGATCTCTCACCAACATTGGGAGCTCCTATTTCCGTCAGATGGCTACATTGTGGTGAT
GTGGATCATGTGGACCATGTGGACCATTTGAGTTGTACAATTCATGATAATGAATTGCAAAATGAATTGAAGTCAACTTCGCCAACCTGAAAGATGCTTG
TCTTCCCAGAGACGTTCTCGTGACCGGAAGCCGTCGCCGCCATGAAGAAGAAGGTGCGCGCCCGTTGCTCTCTCTCCCTTTGTCTCTCTGCCACTGGTCG
TCTATGGAGGAGATGTGTATCCAGGCCTCTGACGCGCTGTGGTCTATGTGTGTGGTTTGTGTCAGGTGCTGTTGATGGGCAAGTCCGGGTCGGGCAAGAC
CTCGATGCGCTCGATCATTTTTGCCAACTACCTCGGTACGAATGCGATGTGCTTGCCGTGCCTGACTGGACAAATGTGTCCCATACTAACCGTATTCCTC
TCGTCGGATATGCAGCGCGTGATACCATGCGCCTTGGCCCAACGCGTACGTAACTCTTCACTGGGAGAGTAGGAATTCTCGACAGTGCCGTTGACGTGTG
TTTTGGAAATCTTCCTTGTGCATGTGCAGTGGACGTTGAGCATTCGCACGTGCGATTCCTCGGGAACCTCGTGCTCAACCTGTGGGACTGCGGCGGGTGC
GTAGCGGCTCTCTCTGAACCCGTAGCTTGCACCATACCATGGTGGTGACACTCTCTTCTGCCATGTACAGCCAAGATGCGTTCTACGAAAACTACTTTGA
GAGCCAGCGCGACCACATTTTCCGCAGTGTCGAGCTGCTGATCTACGTCTTTGACATTGAGAGCCGTGAAGTCGACGTGCGTCTTGTCTTGGCGATTGTG
GGGATGACGGATCAACTCATAGCTTCTCATTCACAGAAAGATCTCGCGCACTTCGATGGGTGCCTGGAAGCCATTGACCAGAACTCGAGCAACGCCAAAG
TCTTTGTGCTGATCCACAAGATGGATCTCGTGCCCGAAGAGCAGCGCGACCGCGTACGTTCTTTAGATTCTAAAGAAATGGGTGTGAGAGACCGTGGACG
CTGACCAATAATGTCGTTCCTTGGTTAGGTCTTTGAGCAAAAGAAAGAGACGATTCTCTCGCGCGTTGGATCGCTGCCGACTGTGTGCTTTGGCACGTCC
ATCTGGGACGAGACGCTCTACCGCGCGTGGTCGTCGATCGTGTACTCGCTGATCCCAAACATTCAGGACCTCGAGCAGCACTTGAACGACTTCTGCGCCA
TCTGCAATGCCGACGAAGTCGTGCTCTTTGAGCGGGCGACGTTTTTGGTCATTTCGCATGCGACCCACGCGACTCACCGCGACATTCACCGCTTTGAGAA
GATCAGCAACATCATCAAGCAGTTCAAGCTCAGCTGCAGCAAGACCCAGGCCCAGTTCCAGGGCATGGAAGTGCGCAACTCGAATTTCACGGCCTACATC
GACTACTTCACGGCCAACACGTACATCATGGTCATCATGTCGGACCAGCAGATCCGTAAGTCGTCGTTATCTCTCACTGTTGGCAACAAGGCTGCTTACC
GCTTGTCACCTGTTATTCTTTCTTGTAGAGCCGGCCGCGATCCACTTGAACATCAAGGCTGCCCGACCCGTGTTTGAGAGCTACGTGCAGCAGACGAGCT
AGGT