Description :
From Genome Similarity Track
Location :
Scaffold_551:69- 4786
Sequence
4717 bases(100 bases per row)
GGCAGCGGGCGCTAATGCATTACCTTTAACAATCAGCAGATGTCGGCTTTCCCAGATCTTCTGGCGTAACCGATCCACTTCCGCGTGTTCGTTCGCCCCT
GGATCCACTTAAGTGTCGTCAATCGTGACCTCCTCTGTGGTCAGTGGTACTCCGGGATCATCGCCATGCCTTCTCCGAGGTCCTCAGCGTGTAGATCCCC
GCCTTCATGGTAACAGACTTGTTCATCTTCAGTCTTCGTCGGATCCACCATTGGATCCAAGCACCGCGACTCTCCTTCGACCGTCATTCCTTCTGTCTTC
GTGGGATCAGGTACCCTGGTACTGGGGAAGTCACCTGCTCGATCGACTTGATCCTTTAGCGAGTTTAAACGCGACGGTTCTTGTTTGACTAGCGTTGCCG
CTCTCGACAAGGATCCAGGCACTTTGTCCCATGAAAAGCTAGGATCCACTTGTGAGTTAGCAGGATCTGGCGGTCCGGCTTCAGCCCTCTGCGATCCTTC
ATCCACCGACCCTGCGTTATCTAGGGGCCGACTCTGGGGATCATCCCCCGTCGTGGATCCAACCTCCATCGCTTGGGTCTCGATCCGACGATTTCTCTGC
AGGATCTTTCGCGGAGTTGGATATGGAGGCCGATCCACCAAGGGGCCAGTTGGACCCGCCGGGAGCTCCACCTCTCCGAGAGACTCGATCTCGGTAGTCG
CCTCGTACGCCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGCCCGAT
CTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCCCCCTGGCTCTGGGATTACTGTAGGCACCCACTTC
TCACCCCGAGTGACCCACCGTTTCTCATGTTCCACCCACTTCAACCGATCTGGCAGTTCCCAGGTTTCTCCGGGCTCGATCCAGGTCGTTATATCCGCCC
TTACGATCCTCATCTTCGCTCCGTACGACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCGGGGAATCAAAGTGTCCCATCCGCCAGATCCAACCT
CACTCCAGCTGGTACCATGAAATCCATCCCGAGTATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCGAACCAGTATACCAAACAACCTGCCAGC
GTGATATTGATCCGCGTTCTCCCATTCGTACGGTACACACCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTAC
GCGCAGAGGCGTTATCTAGTATAGACACCTGGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCCACCTTGGCTTGTCTAAA
CCACTTTCCTGGGGTATGGAACTTCCAGTATCCACGGGACTCCCCTGTTAGCAAATCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTGACCTGA
CAAACTTTGGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATTGGCCATGTTGGCGCTTCTCCCAATAACCACGTGCCTCTCCTCTTTGTA
GATCCAGGGTTAAAGAGACTTCGGATCTGGCAACTCATCCACTTGGCGCAAACTAGAAACCTTGGCAACTGACACTTCATGTAGATCACGTGTAATATCG
ACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAGCGCTCGTCTCGTACCGGATTCAAACCCG
GCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAATCATTGGCGGATCTGGCTGTAAAATTCTTCC
ATCGGACACTTGCCGACGTCGTGAATCTCGCCACGACCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCGTTCTTGTCACACTTCTCACAGACCA
GATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGGGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCC
ACGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGGCGCAGTGAGACAGACTCGACGGTAATCTTCAGGG
TCGGAGTCCGAACCGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAGCTGGTGCCGTGGGCGTCGGAGCCTTTTGGC
GATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCAGCACTTCTTCGAGCTCATCTGCGTCTGAAAGACGTAA
CAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAACGTCTCGATGAAATGATCCACATGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAAC
TTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAACGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTC
CCAATCCACAGTACTGGGTCTGGAAGCTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGC
TAGCAGATCCGCAAAGGTCAAGCACTTCTCAGCATCCGACGCTTGATTTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCA
TCTTGATACTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTA
CCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGAAGTTGTCTCCCTCCACTGACTCCATTTCCACGTCTCGTGCTCC
ATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAGCGATTCATCGCAGCTTCAAAGTGCCGCTGCAGGGTGCCC
GAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGGGACTGGATCCGTGAGGCGATTACCTCGAGCCTGATCTGACGATAATCCCACTGGCT
TCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGCCTTCACGTTCACAGGGGCTTCCCGAGCCTT
CACGTTCACAGGGGCTTCCTGTCTTCGGACCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTG
TCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGATGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGA
TGGACTTAACTCTGGCAAAGAGGTCCTGCGTCGCGGATGCTATGAGATCCAGATCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCC
TGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGT
GGATTCAGGGTCTGCATGACAGGATCTAGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGG
ATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGAAGTCTTACTCATCTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGCTTGG
GTTTGGGTACGATGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTTCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGA
TCCGCTGGGGTGTTCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCTACCTCTCTTCCGTCGACAGAGTTCCTCCCAA
AACTCCATCGATCCGCGGATCTTGTTTCATTCAACAGCGTCTTCGTCGATCCGACCTCCAACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATC
TTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATC
CAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCTTCACCTTGTGTACCCGTCGGTAGGGC
GGGATCTGCCCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGGCTTGGCGGGACGTGTGGATGGGGTGGAGCAGTAGTGGTAAAACCTT
CACTCTGCGTCCGTGGTTGGTTCTGGATCCTAAGCGAATATTCCAGCTTAAGTGGATCCAGGGCCTAGATCGTGGATCTGGCCGTAGGTTTGCATTGCGG
GTATGTTCCCTTGCCTTTGCGTTTTCTTTGCGGCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGACCTTCTAGGGTGTAACCGACCAAGTA
GTAAATTCGGTTAACCT