Description :
From Genome Similarity Track
Location :
Scaffold_3253:69- 2598
Sequence
2529 bases(100 bases per row)
ATTTGTGCACTGCCGTTCACTCAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGT
AGTCAATCCACGCCATCGCGGGTAGACTACCTGAACCTCCGAAGTTCGTTGTCATGGATAGGAACGACTTCTCCCATTTGAACGACTCTCAGTTCAAGTC
GGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCG
TACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGC
CGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACGGCGTGTTGC
TTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGTTGGGTGTACACTCGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAA
CAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGCAAACAAGGAAGGCGCGACCTGCACGAGTATGTGC
AAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCAATGAACACATCGAGAAGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACG
CACTCAGCTGTTCCGGGTGCAGGCCAGCACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAGCACAGCCATCGCCAGGCGCGTACGCCGGCCTCA
GCGTGGCCTGGGAGCTCCTTGTCGGCTCCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGTCACGCTGTTCGGGGGACCCGAACAGCGTGACATCCG
CTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGCGCGACTGTCCTGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCTCGTCCTCAAGGGTCGCTGG
CAGAAGCCAGAATCCCGGGGACAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGTGCGGGTGG
CGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACCGCATGTGTACCGCGGAT
ACGATCTATCTCTTTAGAAATCTCTGAATGAACTCTGGGGCATCCAAGAAATTCGCACGCCGCCCAGACGCGTTGCTCGTAAAGCAACAAGTTGTCCGAA
GCTTTGAGAGAAAGCAAGGGCAACGGACGGTGTCAGTGCGACTGGCCGACGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTT
GAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCG
ACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGA
GGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGC
GCCGGCAAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGTAAC
AGAGTTCCACTCACGGTCGCCCAGACCATAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCT
TAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGCCACGAGTGCCTCGGATGTGTAGCGACGACATCCCTAGAC
GTGGGCAGCAAGCTCCCCGTCACAGAAGCCGTCGGCAAAGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGA
CTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGCTATCACATCTTCGATAGCGAGACGGGTTTACCCGTCAAGGCATCTGGTGTC
CACTTGGAACAGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATCGCTGAGA
TGGTACTCATAAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCG
CTTGGGTTCTGAGATTCTCAAGAACCCCA