Description :
From Genome Similarity Track
Location :
Scaffold_175:69- 2055
Sequence
1986 bases(100 bases per row)
CTCACCACGACCTCCATCACCACGCCCTCCATCTTGTTTGCCTCGTCCTCTCGCCATAAACACTGGTTAGAAGTTAACGATGCCCAACTAATCAATTCCT
ACAAATAAAAACAAGTCGGTGAAATCCGAGGACCCCAAATCCGGGCACGTGTGGAATAGCACCCCACGAGATGTCGCGCCAGAGAACGAGTGACGGGAAG
TGCCGGGAAAGATGGCAGCCGACGAGCGTCGGATGGAATACGACGCGTCGGAATGGCCAGAAATGTTAACGGGGTGATGGGCTGTGTGACACGCATACCG
GCGGTGGAATCAGGCTAATTCTGGCTGATTCGACGAGCCGGTTCATTCGCCCGGTCGTGCAAACCCCGTCGACCCTAAAACCCGTCAACCCTAAACCCCG
TCGAGAAAACCCCGTCGAGAAAATCCCGTCGAGCTCAAGTTGTGATTACGCCACACAAATCAGGTTGAAGGACGGTAGTGCAAGCACGACAGAAGTAAGG
ATAGGTACAGAGCGGTAGACTTAGCAAGCAGTAGTACAGAGTAGCCAGTAGCAAGGACATAGGATAGGGTAAGGACTCAGTCCCGAAATTTCTCTGAACG
ACTCAGACCTCTCCCCTCCGGAAGATCGCCAGGTTCTTGAAACCCACCAAGCGTCGGCAAGCAGAGCCGCAAGGAACACGCGGTCCCCCGTCGCTCGCTG
GCTCGGGCACTCACCCCCCCCCCCCCCCCTCAAACCCCGTGCTGGAAACGAAGGCACGTAAAACGTATACCGGTTAGGAGGCGCTCGATAACGCGCAGCC
TAGACGAAGGACCGCACGGCCTGATAACCGCTGTGCACAAGACCCCGCGTCGGCCCAATAACGCCACGCAACAAGCCCCAAGAAACGCCAGCCCGATAAC
GCCGCACGCCCGACGGGATCTCCGAGGAAACGCCGGCCCGATAAGTCCGCACGCCCAAGGAACAACCGACGCCCTAAGACAAGGAACAAGCGTCCACTCA
ACCTCCCCCCCCCCCAACTCTGAAGCTTGCGAAGACTTGGGCTCTATATTCGAAGATACGCTACTCAAGATCCGGGAAATTGCCCGTCGCGACCGCAGAT
TGGACGCGTCGGGTTTGTGCGAGGGCGATACAAATAGGCAGTTAAGCAGTTGAGCGTGACGTCCACTTGAACACACTACTCAATGGCGAGGGGACCGGAG
GCGCAACGAGATGAGTAAGCTGGTAGGTCCACGAGGAGATCCCAGAATACACCCAGCTTCCGATAAACCAATACAATACAGAGTTATACACAACAAACAG
CCGCCACTTATTCTTCGACCCTTGGGCGGTGGGTCTTACGCCAGTCGACTAGGCCGATTCCAGAGTACTGGTCAACTCTGGGGCCTCTCGTAACGCGCAC
CACCCTCTAACGAGGGAAATATACACAATCCAATACAATCCTCTCTCACAAATGCAGTCTCAAAGTCAAACACTCAGGGGACAACCGCTAATAAATCTCC
CCAAGCTCAATCAGTAACATGAAATGGGACACCACCCTTACCTACACGCAATGGGCCCAACTAGGATATGGAATGCGTGGATCACTTCAGACGCTCGAGC
AAAAGATCCCCACGCAGATGGACTTGATGATGGTGGGGAGCTCCGCGACGACCGTGTCCTTGGCGACCGACGGACCCGATTCCTGGCTGGCAGTGACTCT
CGACTTGCGCAGTAGGGGGTAAAACGAACTCTCTGATTGTTATCTGCTAGATTATCGCTAAGATCAATATAAAGGCTATCTTCTTCTGGGTTCTTCTGTG
TTCTTCCGTGTTCCTTGCGTGCGATCTTCGTGAATATCTTGACTTGAGTATGCTTGGGGGGGGTTGTATACGCCGACCTCGAAGTAGACTGGATTTCATT
CATCCCACTCTTCAGTCAGTGACTTCTGGGTACAAATCAGGTCAGGCATCGTCGCTTGGTTTCAGGCTTGAATCCGAGGGTGCGTT