Description :
From Genome Similarity Track
Location :
Scaffold_1995:69- 1225
Sequence
1156 bases(100 bases per row)
GTATTTCAATCCAATTCTCTTTAGGTTTGAACGAAACCTCCCAGAGTGGCTTTTCAACTCATTCGCTTAGTAGATCATCGGGCGCGTCTTTAACCCAAAG
GGCATGGCGTAATCACTCAAAATGTCCTAGTGCGCAGACGAACGCCGACACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCA
TCCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCACCATCT
TGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGCCCTGCACG
CAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATCGCAGCGGCACGCGCCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGATATCG
CATACCGCTCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCTTTAGCGTCGCGACTAGACGTTCTCGGCGTTCAG
TCGACATCTCAGGATCAGCAACATTAGGCGCAGTGTAGTCAATTGTCGTGTTGATCTCTTCGGTCAGGTCCGGCAGGAATGCCAGCTCCTTCGCGTAGTC
GTCCAAGCCAATGTTGTTAGCTGGGTGTTCGTAGAAATAATTTCTCGTATCCTCCGTTGCTTCATTTCCCTCGGTTGTTAACACTCGAGCAACCGAGATG
TATATTCCGTCCAACGCCGCTACGGATTCTTCCCTTGACTCAACATTGGCATCCGCATTGATTTCAACAGCCGGTACTTGGTCCATCTCCTTCCCATCCT
GGTTTCCCATCTCTGGGCCATCTGCCGAGTCGTCGTTCGCAATATTGAATGCGTGGGCCGCCGACATATTGGGTTGTTGACTTTTGTTCCGCTCCTCGTT
CTGCCGCTGTCTTGACATTTCGGAATTCGCACCAATCTTGCAATGAATACTCGGTGCCGTACTCAACACCTTCTGCGCGATGCCTGTATCCTCTGGATCA
ACCACCGGTGGCTCGTTCGCAGATTTGGTGACACACAAGGCCGGGACAGCTTCGTC