Description :
From Genome Similarity Track
Location :
contig_24:689611- 701051
Transcript NameFunction/comments
g5792.t1hypothetical protein
g5793.t1RAW36715.1 hypothetical protein PC110_g7002 [Phytophthora cactorum
g5794.t1KUG00589.1 hypothetical protein AM587_10015929 [Phytophthora nicotianae

Sequence
11440 bases(100 bases per row)
CAGGTGATGCTGACAACAATGAAACTCGATCAGCAAGGAAAAATAACGGAGAGCGTATCATGTCTCTGGCTACTCGGAAGCGTTTAGAAGCGAAGGCAAA
GCAAGACGCCCAAACTGGTAATGCCAACCCCACCATTCCAGCGTCACCAGAACGGGCAAGACATGACATTCAGAAGCCCAGGAAGAAGCCTATCAAGCCC
AAGGATACTGCTAGAACGGATGAAGTCGACACTAAAGCCCGTCCTTTGGGTAAACAAGACCCACGGTATCTGGAGCTGCATGAGATCACCCCACTCATGA
ATCCAAAGCAAGATCTCAGCAAGATTCTCACCCAACTCCGAAGTGAGGACTGGGAGGCAAACTTTGACGCGATGAATACAGTTCGTCGGCTAGCCATACA
CCACGCGGGCATGATTGATCTGAGCAAGGTGCACGGAATTGTCGCTGAGATTTTGAAGCAAGTCCCGAACCTGCGTTCCTCGGTCTCCAAGAATGCTCTG
CTGGCACTTGAGTCGATGTGTTCGGCTTTCAGTCGGGCGATGGACTCGGAGGTGGAAAATATCATTCCTGTGTTGCTTAAGCGGTGTGCCGATTCCAACA
CGTTTGTGTGCGAGTCAGCAGTAGCATCACTACACACCGTAGTGCTCAAATGTTCAACGTCGCGCGTAGTATCTGCGCTGGGAGCTCACGTAAGCACTAA
AGCCGTACCAATTCGCCGCGAGGTAGCACGTGGTGTCCACGCAGTCATCGTTTGCCAGGCTGACAGTATCTCGACAAGTAAGGACCTGCCTTCAATCCTG
CACTTGGTCGGTCGCTGCCTCGAGGACTCTAACAACGAGGTGCGCGACGTTGCAAAACAGTCAGTATTGTATATGCACTACGAACAGTGCATGTCAGGCG
AGCGAATCAAGAGGCTTCTACCTGCTGCAGCACAGACAAAAGTCGACAGCCTGCTCCGTGGGAAGGGCGGATACGTCTCACCAATGGCAATTTTCCACGC
ACCCACCAGCAGCGTGTCTGAAGTTGTCACTGAGCATTCGGCAGCACTTGCAGCTAAGCAACACGAAACTATCGCAGCGTCCGCAAGACTAAAGAAAACA
GCGAAGCAGCACTCAAGGCGACCGACTCCGCCAACTTCGCGCAACGTAACCCGATCAAACATTAACGCAGATGAAGTGTCTCGACTTGAGACGAAGCTTG
ACAGCAGCAACTGGAAAGACCGCTTCGATGCGCTCAATGAAACTACCGATTTCATCCGTGGCAGTGCATCAGCTCTCGTGGGAAGCAGCCAGATGCTGAG
CCTGTTCGACCAGCTCATTAAGCGGCTGGACGACGGCAACGCCAAGGTAAACGTACTAGCTCTCGAGTGCATGGAGAAAATCGTCCCTGCTGTAGGCACC
GGGATGGAGCAGGTGCTGTCGAATTTCGTGCCTGCAATCGCCAAGAACCTTGCCAATGCTCGAACGTCGTCACTGGCCCAGTCCGTCGTGCAGCAGCTTT
GCACACATGCTGACAACCGCTCACTGTGCCAACATTTTGCAATCCAAGCTCGCAACACCAACTCACGTGTGCTTCCAGTGGTGCTCGATACGCTGGCGCA
GCTGACGGCGCAGAGCTGTGACGACAAGAACAACTACGTGCTCAATCGCCACGTACTTCCGTTGGCCCTCGGCCTGCTGAAAGAAGCCAAAAGCGACGTG
AAAGAAGCGAACGCAAAATTACTCTGCCAACTCAGTAGGACATTGGGCCTCGCCACACTGTCATCCGCAGCCTCCAAACTGAGCTCCTCACAGCAAGACA
AACTAGCAGCCATTCTTCGGTGACCAGGATGGCCCATTCATAAACTATGTCAATTACGTTGCATAAGTAATTTTTGACGCAACATTACAAGTTGCAGCAC
TATATTACGTTGCTTCAAGCCAGAGTTTGAATTTTGAGCGCCAAGTTGGCCCCTCCGTTCATTCCTCGAAAGACGAAAGCAGACATGACGTCTACGCTGG
AGAAGCCTCAGATGCAGGACGCGCAGACGCCTGAGCATTCCCAGAAGCAGGACGCGGAGATGCAGGAGCAGCCTCAAACGCACGACAATGAGCCGCAGGA
CGAGCAGAGGGAGGAGCAAACGACCACGGAGCAGAACGAGAACAACGGGACGGACGTAGAGACCAATGCCCCAGTCTTTGACGAGCAGCAAGAAGAAAAT
AACGAGGAGGAGACTCCGCAGGAGAACGAGACAAACGTTGAGACGCCCGTGGAGACTGCGGACCACGAGGAAGACCAGATAGCAGAGACACCACAGGAGA
AGAGCGTTGCGACGCCCGCTACTCAAAAGACGGTGACCCAAGTGCCGGCTTCTACGTCTGCAACCAAGAGGAAGTTTGACGCTCTCCACGCTCGCAACTT
GGCGTTGGAACCTTCGATCTCCGAACACGAGAAGAACAAGAAGGCGCGTGCATCGGCACTCATGAAGTCGCCGGCTACGAAGGTGGCCGAGACGAAATCT
GCGACTGCCAGAAAATTTACCAAAACGAGGGAATTTTCTTTTGCCAGACCGACAGCTTCATCTGCGCGCCGTACAGCTGCAGCTGCTACTGATCACGCTC
GTGCCAAGGCGACGATGACCCTGCCGGGCCGCAAGCCGCTACATGCTAAGAACAACAAGTACACACCTGCCAAAGCTCAGCGAGCGTCTATGCCAGTTTC
CAAGACGTCGGCGATCATGGACAAGGCGTCGCGTCCTCACTTTAACTATACGCCGTACTCGGGCCCACTGCCGGCGCTGACGGTCGAGTCGAGCTTTGCT
CCCAAGAACGTACAGGGTTTGGAGCGTGGAGCGCGTACTGCGTCTCCTGCTAGAGCGAAACCAAGTGCGGCGGTGAAGAAGGTGCCTTCGTACAGGATGA
CCGGTAAGGAAAACGTTGGTGTGAACACGAATGGCGGTGCAACTACTAACACAACTTCGAGCAGCAAGACCCACCGAACCCCGTCAAATACCGCATGCGA
TCACCTGTAACCAAGGACATGAACCGCTCCGCGTTCAAGGAAAAGGTCAAGGACCAACGCTTGGTTGCACAACAAGATGCGAGGGTCACCCCGTTTCAAC
GAATGCCACACCCGTGGAGATAGCCGGCCGCAACGGAACTTTGTTGTAAGCCCCCCGTATATATCGTGCGCTATTCCTATTTGCATGACGTAAATTCGCT
CTCCATTTCGTCTATCTTCAACAGCACGGGCGCCAAGTAATGAAAAGTGTTGTCGTTCTCTATTCTTAGCGTCGACGCTATAATTCTCCGTCCCGTGCTA
TTGCTTCTATCAGACAACCAAGAATTCCTTCATCACAGCGCTGAAGTGTGGTCATGGCACGAGTAGTGTCGCCGTTGCCTCCAAGAAACTGGCTTCGCCA
CCAGGTAGAACGACGAGTTCCACCCGCACGCTCAGTTACCACCTCAAGGACGACCACCAGCGTGCGCAGTGTGTATGATACTGCTCTGCACATTGATGAT
CAGACTGCGAGCCTTCACACCGACGAACGTGGCGACAAATCAGCAAGGGCAGGCATGTTCAAGCGCAATGGCACCAATCGCGAGTCTTTTTCTCGGTTTT
GCTGCTGGTTCTTGTCGTATGCCTGAGCTGGACGTGTTGGCTGCTACTGCTCGCGGTAGCTCCCAACGAGGCGATCAACTACGTCATGAGGACCACGGAT
CTAGACAATGGCTCGTTTTGGATGCTGGTGGAGCCAACACCTACACTTCGAGCACTAAGTCTCATTGGCCTGTCGATTGTGGCCATAGGATACCTCTACG
TCGGTGCCATGCTCCTTGCCTCGGAAAAGGAAAGGACCACACAGTGCGGACCATCAATGCAGAGTCAAGACCAACGAAAGCAAGCTCAATCACGGAGAGG
CAGTGTAACACGTACTACGAGCTCTGTATCTTCAATCTACCCGCTCCCATCGCTATCCGGAAGAGAAGATGCACAACTTCCGAAGATCGGATGTTCATCC
AATTTGGGTATCGACGTTTACAATTTTTGTTTGAACGTGTGGTGCAATCACAGCGATGCTCGGAAAATTGCGGTGAGTGAACTTGTACTCGGGTGGTGCT
TGGAGGAACTTATATTAACTTTGGTGTGTGTAGCATGTCTGGGTAAAAGTTGGGGATTTGATGCTTCAAATATTCATGTTGTACCAAACACTTGAAGCAG
GTTACCCATTGCCTCTCGTCGTAGTCTGCACCTGGATAGTGGTGTGGAATGCATTCGCAGTCGTCGTGCTCATGCACTCGCCCTCGCCTCCGTCTCAAAT
TGGTGAAGCTATCGTTGACGCGATGTAAGTGTTCATGCGCTATACTAACTACTGTATGCAAACAACGAACTAAAATGTGTCCACGTGCAGCTCAGACTTG
CTTGTATCAGTCGGCTTCCCGGTGCTGGTTCTCATTTACTGTCTCGAAACCTTTGAGTTTGATCGCGAGAGCCAACGCCTTGCGGTCGACCTCTTTTCTC
CCTGGTCCTTCCAGAATGCTGCGCGCGTACATGCAAATCCAGAGCAAACAGCGAAAATTTACAAGAGCCTGGAAGGTCTTCGCTTTCAGTCGGTTGGCGT
TTGCATTGCTCGCTTAGGCAACAACCTCGCACTGTTGATAAGTCTTCGGCGTCTGGTCAAATTGCTGCGAGCTCCAGTTTCGTCAATGTCAATGTGTGAC
GTGGAAACAAATATGAAGAGCAGTATTTATCCACGGAAACACCCACTGCTTTGCTACTTGTAGCAATCGCCATGGGCACTATCGTTTTTGTGGCGGAGAG
CGTACACCACTCGGACCAAGCTTGTAAATCATATCCTACCTGCACAATGCACGCCCACCGCTGGTGGCTCTCCAGCCGAGACGAGTCGACCAACCCCGAG
ACCAGCAATGCAAACTGGAATTGCCCTTGCCGTGTACTAATTGATGTGGATCTCTCCCCGTCAAGTTTCTCAGCGTGGAAGGATCCTCCCGATGCTACCG
ATACTGTGTCTAGTCTCGCTGCTTCAGGTGATTTGGAAATCTTACAAATAATCAATCGTCAGCTACCTCAGCTACCAGAGACACTGCGCCGATGCAACCG
TCTCAAACACATGTACGTGAATGTCATGTCGACTACAAGTCATCTCAACCTAACGCTTACGTTTTTATTCTCCAGCGCATTGGTATTCACACACACGACC
GCATTGCCGTTGTGGGCTGCCGAGTTTACAGATCTGGAATTCTTGCACATTGAGGGCAAGTCACGGACTTTGAGCCTTGCTTCATTACCGCAAGGTCTTT
TCAGCATGATGAAAAAGCTCACGTTTTTGCATCTGGGAGATCACTCAACGTTGGCCAAACTTCCGGATGTTGCTGGTCTTACCAACCTCAGGTCGATCAC
GATGGCAAAACTGGAGGCACTCGATTCGTTGCCTGCAGATTTCGCGCAATTGGAGCGACTAGAAATTGTGCTTGCACTCATGGTGTCAAAGTTGAAGACA
TTTCCAGATCTCTCTCGGACTCGGCAAACGCTTAAAGCCTTGGTGATTGACGTTTGTCCTCTATGCTGCGACGGGTTCTTACAAACTTGTGATTTAACGA
GCAGCACCTGTGGCCTTCACGATCCAGGACAAGATGATCCACAAACGTGCTTACCGGTAGGGCTTTCCGCTACTTCAGGGACGCTTAAGCTCTTCCGGAC
GTTCAACTCGACAATATGTGTGAATCCACCAAGCCCACCACCTCGTGGTGACCAAGACAACCCCCGCAACGACAGCGGTCCAGCTGTTCTGGTGCCACCA
GGTTCAGATCTCGACGGAGCTTTAGAACGAAGTATGCAGCACTGTGGAGGAACCCTTTTTCGCGAGTGTAATCAGACGCCGGAATCAAGCTCTGGAATAT
GCTACAGCGACCGGTACATGCCAATTTCGTGTCTTGGGGATCCCAATACTATCAAATGGCGACGCCTGCAAATTGAGCGACACGTCGGACCAGCGTGCAA
CCCCACGTACGAGGCATGGCTGGGCTGCAGACCCTGATCGAAGCATACCTACTGGAGATTCAAAATCAAATAAAAGATACATGTAAATCGAAATGCAGCC
ACCTGGGCACTCCTTAAAACTAGTTTGCTAGCATGTCCTTCATCTTCCTGGTGCTGGTGATAAAATCTGCCGTGCTCTCCACTCTCCACATCCGAAGTCG
ACTTTACTTGGGCCAAAAACTCGTCGATGTAGGCCGCAACCTTGTCCCCAATGCGGCCCAACGCTTTCGCCTCTTCACCGTTTCTCACGGTCACATCCGC
ATTGCGCAGTCGACGAGCAGCGCGCACGAATGCCGTACCCCGACTGATGTGGCCTTATAGAGCTCTTCTTCGCCGTACTTCACTAGTGCGTCCACCAGAA
CTTGGTTCGCCTCGACTTGCGCTTGCTTGCTGCAAACATCTTGCACGATTGGAGGCACCACGGAATCCGGCTCACGCTCACCAAACTCGCTGGATTCTTC
TTCTTGCTCTTCATCGTAGTCGTAATCCTCGTCGCTATCTGCATGACCTTGTTGGATGATCTGGTCGATCTTAGCTGAAATGCGCTGCCCCACCATGTCA
ATCTCCTTGCTGGCTTGCTGTCCTGACTGCACAATCGTCTTCGCGTCTCGAATGGCTTGGGCTGCCCGCAAGTGTGAAATCCCCTTGCCTCTGTGACCAG
AGTACAGGTGGCTGTCGCCATAGTCGACCAAGGCATCGACGATAGGTTGGTTTTCAGGACAGGTGGCAGGCTTTTCGCGCAAGTCCTTGACAATCGGAGC
CAGCGTATACCCACCACTACGGCGTGGGTGGGTTCTGGAGCCGGTGGTCTCGCCTGTATCCTGAACAATGCGGCCGTGCGTCAGGATCTGGTCAATCTTG
TCGGCAATCACATCACCAACCAGCTGCACACTCGTACGAGCCGTCGAACCATTCTTGATAACATGCTCCGCGAGTTGAATCTCTCGCGCTGCACGGAGGT
GGGTCGTTCCTTTACCCGAATTACCAAAGTAAAGTTCGTGTTCCCCGAACTTTGTCAGTTCGTCAACCAAAACTTTGTTTTGAGGACACTTCGTTCGCGA
CCTGTGAATTTCGCGCACAAGCTCCGGCCGCGCATGGTTGGCCACGTTGTCGCTGACGTTCTGCCCAGAAGTAGCATCCTTCAGTTTCCCCGTCGCCAGC
ACTTCTTCGATCTGGGAGGCAAGCTTCTCTCCAACCATGGGCACGGCTCGGGCATCTTTCGCCGACGCAATGGCATCTGGGTGGTTCCGAATGTGAATTG
CGGCGCGCAAATGCGAGACCCCCTTGCCCGTGTGTCCGTGGTTCAGTTGGTCCTCGCCATAGTCGGTGAAAGCATCCACAATCTTCTGGTTAGCCGCGTT
TGCAGCCTTCTTCTCGCGAGCTTCTTCGACCAAACGCAAGGCTTTGTGGGGAGCGATGGGTTCTTCATCATCGCCATCAAGCTCATACGCATAACCAATA
GTGCCCGGGTCGTTGTCATCACCCCCATTCTCATCACGCTTGCTCTTCTTCGAGCTTTTGTTCGACTCCGCAGGTAGCCCACGCTTGGTCCGGCCGAACT
TGGCAATTAACTTCTTCAAAGCACTCTGTGAAAAGGACCCAAGTCGAAATGTACATTAAGAGGATCGTTCTCAGCAAGCTGCATTGGTAAATATGTACCT
GCTCGTCTCCGTTAGAGGCAAGTAGAGCCTTTGAAATCTCACTGGTAGCCGCATAAGTGTTCTACACATCGACAACAGCCGAGGTTAGTCGAGTCTGCAT
TCCTCTGGAAAGTGAAAATGTGGATTTTGCTAACCAACCTCTGGGATATTGACGCGGTTACTCTTGCAGGCCTCGCGCATCTTCCCGATATGCGCGTGAA
CTGCATCGGCAGTCGTTGCGTCGGTCATCGTCACTTTGGCAAGAGCGGTATCAATGCGTGCGCTGGTTTCTCGAAAAAGGAGAATGAGAAGTGGGGATCG
ATCCGAAAATCTTGGCGAATTGATGCCACAGTTAGCTCACATCTTCAAGCGGGACAGGAGGATTCCTCAAATGGCACACGGGAGAAACTTGAACAAGAAA
AGAAGTGAGACGTGGGCCTACCAACTGAAATTGCTTGAGGCCGTCGCCTTCGCAAACAGTAAACTGCTACCAATAAACGTCGAGTTGCATCACTACCTGG
ACCGCTTTGACGACTGCGCGATCACGGAGTCGATAAACGGTTCGACCTTATTTCCCTTGCACAGCCCAGAGCGCTTGCCACGCTCCCGCTTGTCACCAAC
TCGGCAGCATCACACGGAGGTGGCGTGCAGTACCTGGACCAGTGTGTCACTTAGCGAGTTGCTTCGCAGTGATCGCGTCTACCAACTGGTTCCCCTCGAC
TTGAAATGGCTTGCTTCGCAGATCGTAGACAATCGGTGCTGTGTCGGAAGGTCCGCGAACTCCGAATTCGCTGCCTTCCTCATGGTCATCGTCGCCTTCA
TCATCATCTTCGATGTCAGCGTGACCGTGCTCCAGAATCTGGTCGATCTTGGCTCTCACTCGAACACCAACATAATTGATCGACCCCACTGCTTGTTTGC
CTGATGTCACCACTACGTCTGCGAATGGCTTTTGCAGCACAAGCGTGTTGATCCGCAGAGTTTGTGTATCAGTAGCTCTCCCGCTGGAACTTCGCAGCCA
GACAACTCCGAGCGCGCTGTTGATAAACACACATGACATGAATATCTGAAGAGCTCTCATCGGACAGGTTCCAGTAAATGACCTCTTCATCTCCGTCAGA
GGCTGATAGCGCTGACGAGATGGCAGAAGAAGCGTTGTAAGCATTCTGCAAGACACCGGAGGTCAGCTACAATTTCGTGCTGCACAACGGAGCACCAACT
AGTAGACCAACCTCAGGAAGAAGAATCCCGCTTCGTCTGCAGGCGTCGCGCAAGTTTCCCAGGTGCTGGTACATTCTGGTAAACTCGTTCAGCCAGGATT
CGCAAACCGGGACAGGAGTCTTCTTCAATTTCTGCGCCATTGAAGCCCTTTCTCGCCCAGCAACGTGACCCAACTCTCAGCAGCACAGCCATTTCTCCAA
GCGATGGAAACTACAACTGTGGACGACGCCTTCGCGCAATTCAGTGGCATCGGGACGGCGTATCTTCGAGCCCTCGAGAGTACCCGTGCTGACCGCCTCA
TTAATGATCCTTTTGCGGACGTGCTAACGCGTGACAGCCGGGGGGAGCTAGAACAGCGTCTATCTACTGACCCAGACTCTCTGTGGGTAGATATGGTTGC
GATTCGTACTCGATACGTGAATGAAGCGCTGGCACACCGCGACGCTACCATCCACCAAATTGTTTTTCTCGGCGCAGGCTTGGACACTCGAGCGTATTAC
TTGGAGTCTCTGCGTGACTGCCATGTGCTGGAGATCGACCAAGGTTCGCAGCCGTTTGATCGCAAGAGGGAGGTGATGAAAGCTGAACAAGTGCTGCCGA
TTACGAAGAAGCTTGACTACATCGTAGCTCATCTTGCTGAAGACGACTGGGACAGCAAGCTGCGTGGGCATGGATTTGACCCACGTGTGGCCACGTTCTG
GGTGATGGAAGGACTGCTTCCCTACATGGAGCGCTCCGCCATTTGGACGTTGCTCGATACGATCGATGCGATGTCTGCTCCCGGCAGTACGCTTTGGGCC
GATATGGCTGGCCAAGCCATCTTCACTTTCGCAGATATGGGCGATCGCGCGATGAAGCATAGCGAGGATGATCCTATGCGTGGCGTTTTGAGCCAGATTC
CTTGGTGCTTGAAGTTGCAGGCGTCACTGGTGAATGCTGGGACGCATTTTGGCCGTTCGTGGCCACCGCTGGCTTCCACGGACGGCAAAAGGAGTGTCCC
CATTCCAATCTCATTTCTCATCGGCCAGAAGCCTGTTCCAACGGAGGCTCGTGAGAAGGATGTGTGCCCCGGCCTGGAAGCGTAGGAAATAGCCAAGAAG
ACCCACCCACGTAGTTAGTTGAAGCTTTTGGTCAGCTACAATCATGCTGGCTGCTCAATGAGAATATGAGAACGGGCGACGCCCACTTTCTTAGCAAAGC
GCCACAACATTTTCTTCTTGCTTGCCCGCAAGAGCGATATCAACAGCGAGATATGGATCCTCAGTTATTCCAAGTGAGCGCCTCGCAGTGGATGATACCT
TTGCAGAGTCCATGGGATTCGTGACGACGTACCTTCGAGGGGTGGAGAGTGCTCGTAAGAACCGCCTAATCAATGACCCCTTCGCCGAGCCACTTACACG
AAAGCAGCAACAGAATATTGAGAAGGTTTTGAAGGAGGTGTCGAGCTTTTTGCATGCTGTCCCAGTTGACGGTGTCGCGTTTCGCACGCGCTATCTGGAC
GAAGCGCTCTGTCACCGCGATCCCCGGATCCTCCAAATTGTGATCCTTGGCGCTGGACTGGATGCTCGTGCGTACCGTTTGGAGTCACTCCGCGGCTGCC
ATGTTCTGGAAGTCGACCAAAGCGAGAACGTGTTCGAGCACAAGGCTCAAGTGATGAAGGAACTACACGCACCACTGATTGCTCAAAGTGTTGACTGCAT
CGTCGCCAATCTAGCTCAGGCTGGACTGGAAGTCAACCTGATGGGGCACGGATTCAATCCGACCATGCCGACTTTCTGGGTCATGGAGGGGTTGATCCCC
TACATGGAGCGCTCGAGGATCGTGGAACTACTGAAAACCATTGATTATCTCTCGGCTCCTGGAAGTGAATTTTGGACGGATATACCCGGTCGTATTCTTA
CCGATGCTGAAGAGTGGGAAAACCGCTGCATGAAGTACGGCGAGGACGACCCGTTGCATGGAGTTCTGAGCGAGATTCCTTGGACTCTTGAGCTTCAAGC
ATCGCTCAAGACTGCTGGAGACCACTTCGGTCGTCACTGGACCCCCATCCTCTCCACCAAGAGCAAGCAGGCAGCTCCGTTGTTCTTCATCGTCGGCAAG
AAACCGATTCCCAGTGTGGTGGTGGAGCAGAAGATGTGCCCCGGGCTCGATTTTGAGGCCTAGTTGGGCAGTAACGCCCTTCGTTATACCATTTCCTTTG
AATCAATACTTGCAGTCGTGAGTTGCAAGAATGAAGCATTTGCCATTTGCTCTGACCATTCACTTTCGGCCTTTTCCTTCAACTTCCTGCTCGTCAAATC
AGCAGCGCATATCCCAACTTGTGATCTGCACTGCATACAAAGTGACTGGTGCTGGCAAAGCATTATCAAGGTCATCAAGGAAACGTTATACAATCATCAT
GCGTTGTCACCAACTTCAGTGCTTATTGGCGCGAGGATAGCGCTGAAAAAGTGCAATCGGCGTCGATCCGGAGTGCCCAATATCCTCGGACACAAGCAAG
CCACTTGGCTGGAACTTCATCAACGTCACTTCCTCTTATT