Description :
From Genome Similarity Track
Location :
Scaffold_905:6894- 9199
Sequence
2305 bases(100 bases per row)
CTGATATATATGGCTCAGGGAGGGGGAGGAGGTTCGGGGTAGCGGCGGCGTCTCGAGCGATCAAGGCGctccgctttcttcttgttcttgttcttcttct
ctggGCCgggcttctcgtcgtcctcccCGCAAAAGCAGCTATGGCGCACGGAAGTGCAAAGCGCGCGGGCAGGCGGCCAAGACGGCGCCCTCTGTTCTCG
GAAGCTCTCTCCTCTCCAGAGAAAAAATCCCTGGTCCTGGCCCGTCTGTGCTCAGCATGGTTTGACTTGCCATTTGTATGACAGTGCGCTTGTTTCTGCA
CCTTCACCCGCCAAAGTACGAAAGATCGCAGCGGGCGCATCACGCAAGCCATATCGGGTTTTGAAGGATTTAGGGGCGGCACACAAAGGAAGCCATCTGA
GCGGCCCCAGCTGGCAGAGACGCGCGTAACGACCAGCACAACAGCTCATGCTTGTAACTCGTGTCTAAGGACTAAGGACtcggtggcgatggcagcggca
aATTTGAGCACTGGACGCAGTAGAGACAAccacgttcttctccttcttcttcacagcgGTGCCGCCAAGGGCGATGATCACTTGAAGTTGGCCGCAACCA
CCGTCACCTACCCACACGAATCAGGGCGATGTTTTGGGCCCTGCTGCTGATTGAGTCAGGCTGCCTCGGACCGCGAGTATCTTCGTCAATACGACACGGT
AGTTAGTTAGCCAAAGAAGACGGTCTCCTTCGTACCGCAAGGGCAACCTGTACAATACTGCAAGatgcaagctgctgcaggccgcTTGGAGTACATGTAC
CCGCGGCAAAGACATGATCTGGACTAGACCTGGGGACCATTGTCGCACCGCGAGATGACGGGCTGTGTACTGAGTCAGCTGTGCCCCTTGGCTAGCAGCC
GAGCTCGCAAAAGGGCAACTTCATCATGAGCCGCTGCGCGCACagctgcatgagctgctgccgggAAGGCTTTGTCGGCACCGAGGCAAGCTCGCCGTGA
TGGCCGTGGCCTCGAGTGTCGGAACATTCTCGAACAAACCGCGCATAGCGCGGCATGAGTCTGCATTCTGCGGCTGCGCGaatgaagacggcgagcgTAT
CCATTATTTCTGTGCAAAGCCCGAGCGAACATGGCTCCCACCCGAGGCTACAGAGAGCGGCCGGCCGCAGCGGTGGTCGACACCTTCGCTCCGGCCCGGA
GTTGAAAGGCTCGTTGCCCTTCCTGCAGCCGCTGAAGCAGGGTGACTGCCGTCAGTTCGTGCGTGCTGCTTCGGGGCCCCTGAGCCGAGCGCTGCTGTTT
CGGATTAATCGTAACGTGGCAGAGATCGATTTCACACCCCAGCTGAACACTTGAAGCGGGCGGCGCCGGTGCACCGCGGCTGAAGCAGGcggcttcaagc
agctccagatGCTCCTCCCATGCTATGCGTGACTTGTGTGAACGACTGGCGCTCGAAGAGACATACCGTTTGCCTGGAGTCACAAGCTGCAAGACcaagc
aacttgctgcttcgacacGCACACCGGAGCTCCCGCCGGCCAGCTTGCAGGTTGAATCTGTTCGCACCAGAGAGCGTCCACCTCTTGAAGCTCGATCGAT
CTCGTTCGCGACGTCCacattcttcattttctttCCCAAAATTTGAGCTCGCGAATATTGCGCCGCAGTGACAATGGCCTACGCCGCACAACGCGATGAC
CATGCTCGGCTGCAATGGCAGAGTGACACAAGCGACAGAGCCATGCTGCACAGGAGACGCCTTGCAATTTTCGGAGGAGCGCATCAACAGTGGCCGTCGA
GCTGCTTTTTTGGCAGGCACGACAGCGAAGGCTCGCGTAGACTGCCTTCGCTGTAGACTGCTACTAGCAGTTGTAGTGCCCAATTAATCATGCAGCTCCG
TCCGTTTCCCGACGTTTGGCGGGTGAACCGACGCGTGAAACGGCCTTCGGTCTCAAATATCATATTGAGtgacgaagaaggtggtCTGTCATGACTTCCA
TGCCACGCACGCGCTTTTCTCACCCATCGACGCTGGTGACACTGGTGCATGCAGTCTTGGCGCAGTCTTGGCAGGTCTCGTGGCTATTGGAAGAGGAAGG
GGTCGATTTGAGCCGCGAAGCGAGAGAAACGGTTGCTAAAGTTTTGATAAAACTTTGAAGTCGTGTGAAAACACCTACACTGCCCCTCCCCCCCCCCTGC
AAGTGGCATGGCAAAACGTAGTTTGCCCTACGTGTACTTTGCTCGCAGTGCCATCATGCTCGTTGCACGAAGCTTGCAATGCTCGTTGCAAGAAGCTCGC
AATGC