Description :
From Genome Similarity Track
Location :
Scaffold_5:689220- 690564
Transcript NameFunction/comments
Phyci_157715Hypothetical protein

Sequence
1344 bases(100 bases per row)
CCCCGTTCCGTTGCTCACGAGGAAGTCCGACAGGAACAGCAGATACGGAACATGAGCGGTGTCGAGCATTCCCCAGCAGGCCATCACTGGGCGGCGCACA
GAAACATCCTCGCCATCATCGCTCCGTAGTGGTGCGGTTAAATAGTACCCGCTGTTCACGGACGGAACTCTCGATGACCGCAACAATTGAGAAAACTCAC
TGGTCGAAGGCATCGGCATGCGTGAAAAGCTTGTGCCTTGCTCAGATGCAGAGCTTTCTCTGTCGCTGTACTCGGACGTGAAGTTGCGCTCGATTGAGCT
CAGCTCGTGCTCAATAGCCAGCACGTACTGCCGGTTCTCAAACGCCAGGTCGTCATTGAATTGAAACAGAAGCACCATCGACACTGCTGCGATAAACGCA
CCAAACAGCAGAACCGGCCGCAGCGCTGCCAGTGTCCACACATCACCATGTTTCCACAGCAGCAATATAGCGCTTGTCGGACCTAGCACGAGCGCGACAT
TGCGCATGACGTACTTCAGCGTGAACGGCGCTGATCGTTGACCAATTGGCACCGAGTCTGCAAACAGAGCCTCCATGGCAGAACTCTGGAAGGCAGTGAA
AGCGCCCCACAGTCCGAACGCGACGTAAATGAGTGGCATATCTGCGAGTTCGAAAGCCATCGCCGTCAGTACGGAAGCTACGACTCCAACAATGCCCGCC
ACTATGAGGATGCGATCTCGACGGCTGCAGTCTGCAGCGTACCCCGCTGGGAATGCACATACTAGCTGGGCTAGGCCTTGAATGCCCTTGACGAACCCTA
CTGGGGCGTTCGAGGCTGTAAGCACGTAGACGTAGCCCGACAAAACCTGCTGGGAGATGATACTGTGATGGCAACGTTAGCTCGGACACTGGAGCGAATC
GTGACTTGCTAGTTGGTCTGCTGCGCACCTGCTAGCTGACCAGTAGATCACCGTGAAGAGGAACACGAGCTGCACGTTGTGCTCCATCAGGTCCCATGAT
GCCTCGCGCATGCTGCCGCACACACAGTGTTCTGCGTTTTTTGACTGACCCGTGCTACGCTCGACGATCAACTGGGGACAGGTTGGTAGTTACTTGCCTT
TATCGCATGCTGATTCAGCATCGTCCGTTTCAGCATTGCTGAAACGGACGATTCATAGAAATCGTCTTATTGCCAAGACACGAGCGGTGATGCACACTTC
CAGCAAGAGTAGCGGTTGCATTCCGATCAGGTCAACGCGCTGGTGGTACCTTGGCTCAGTAAACGACTCGGGCTCCCGACTCGCTTCAACATGGGGCCGA
CATTGAACTGCAACCGGCTGCGGCAGGCACAAATCGACTTTGCA