Description :
From Genome Similarity Track
Location :
Scaffold_264:68919- 71907
Transcript NameFunction/comments
Phyin_T30-4PITG_21284Leukotriene A-4 hydrolase%2C putative

Sequence
2988 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGAGAGA
AGCGGACGTCGCTCTTCCTGCCTGAGAAGATGATAATGCGTGGCTGTCCGCCTCCAGACCAATTCGATAATGGCCGAGGATTGGTCAAAAGTGTTTTGGC
CAATAGGAAGAGGATAAATGGAATTTGATTGGTGAGGACCGTGTGCCTACGGTTATTCGATCCCGTAGCCAAGCCAAGTGTACCTTCTAAATGGTACGCT
TTAAAAAGCCAACCTAAATTTTGAGAGCACATTTAAAACAGACAAAGAATTAGCAAAGGCTGACAAAATCACACCCAGACCACAAAACCTACTACACACA
CACAGGCACGCTGCACCACACAAGAAATTGCACATTATGGCACCCCATGCCTCCGATTTATCTTCAAGCTTAAGATAGCTCTAAATACCACCGATTTACA
TGTATTAATATCTTCTTACCTTAAAGTAGCTTATAGTAATGAAATTTAAACTTTGTTTTGAAAGTAAGGTGCACAGTATGCAATCGGCCATTTCCAATTG
GTTGCTGATATGTTATCGCCGTACGTGTGGACTAGCGCTGCTAGCAGACAAAACGAAGCCCGCAGCAGACTATCATCCCCCTAAAAGGAACCAAACCACA
GGCCATGTAGACGAACAGCGCGTTTCCTGAATCCCTACTCTTTTTCGACTATGCGACACTTTTACGCTCTGTAAATCGTTTCCGATGTCACTAATCCCAC
TTTCCCCTCCACAATAACTTGTGCGGATCTCTGGACACACATCACAGCTCTCATTCGTCAATACTCCCTGTTCAATATCCCCACTAAATCGCAAGTGAAA
ATGGATCAAGAGCGCCCCCTTCGCTCGCATTCGTACTCGAACCTGGACGAGGTGACGTTCACGCATCTCAATTGGGTCATTGCGCTGGACTTCGCAGCCC
AGCAACTCAAGGGATACGCCGAGTACACGTTCCACCACGCCTCGACCGCCACGTCCTCCGTTGTGGTGCTGGACACGCACCATTTGAGCGTCTCCAAAGT
CTATGCAGACGGCAAGGAGACGCCCTTCGCTCTGGCCGAGAAGGAGCACCCGGTATTCGGCCGCGCACTCGTGGTGTCCGTGCCCAGCCACGCCACGAAG
ATCCGTGTGGATTACACCACATCCGACGCCTCCAGCGGCCTGCAGTGGCTCAGCAAGGAGCTCACAGCCGGCAAGACGCACCCGTATCTCTTCACGCAGT
GCCAGGCCATCCACGCACGCACCATCGTGCCGTGTCCGGACACGCCGGCGTGTAAATTCACGTACTCGGCCACAGTCACGGTGCCGGACTGGTGCACGTG
TCTGATGAGCGCCATAGCAGACCCGCAGGGCCGCAAGAACCACAACACTATGGACGCTACCTACCAAGTCTCATTCCAGCAGTCCGTGCCCATTCCTTCC
TATCTACTGGCCATCGTGGCCGGTAAACTGGAGAGTGTGGACTTGGGGCCACGTAGTCGCGTGTGGGCGGAGTCTTACGGTGGTGACGAAAGCTGCCCAC
GAGTTTGCGCAGACGGAGGCGTTCTTGCAACACGCCGAGGAGATCACAGGCCAGGAGTATGTGTGGAAGCGATACGATCTCGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGGTTTGTTTAGTTTC
ATGGTGAGAGATTACATTTGGGCAGCGGCGGCGTTTGTTCAGCATGCCTTGATGACCGGAGAGACAAAGTCTTAACATGAAGAGTGCGTTTAAGGACTTT
TTAACCAGAACAATCCAGCGTGGGCCAATATCAAGGTGGTGATTATTGATAAGAATTTCACTGAACTTGGCGTACTAGCAGAAGAACTACCTGGGGGCTA
CAGTGATTCTTTGTCATTTCCACGTCATTGACTATCTCAAACGCGAAATCAGCAAAAACGTCTACGCGTTTACGGCATTTGAGAAGATACATGCCAAGAA
CTTGATTACGATGATGGTGCGGACTGATGATGAACGAGAATTCGATCGCTATATGCGAGCCCTTCAAGCTCTTTGTAAGAGTAAGCAACAATTTTTGGAG
TATCTGGAAGCCAATTGGTTAAGCTGTAAGCCATTGTGGTGTACGTTCCTGCGCGGATGCATCCCTCACTTGGACAACAACACAAACAACCGATTGGAAG
CAAGTTGGGGGGGCTGCGAAAGGTATTCTTCATCGCCACATGCCCATGGATGAGTGCATCGACCATTTGCTTTTTCTACAGCAGATTGCCGAGGATAAAT
ATCACAGCAAGTCGAAACGGGTTGGCGTCCGTCACAATCACAAGTACGACGAAGAACTTCAAGTCTTGGCAAAGATAGCAACACATAA