Description :
From Genome Similarity Track
Location :
contig_6:68911- 71510
Transcript NameFunction/comments
g2198.t1RAW36924.1 hypothetical protein PC110_g6794 [Phytophthora cactorum
g2199.t1hypothetical protein

Sequence
2599 bases(100 bases per row)
CTGCATACGCGATTCGACAGCTCGACGCGTAGGCTTTCTCTTGCGGTTCGAGCGGCGTGCACTTCCAATACTGTCGCGCATCACACCACTAGCGACAGGA
GAAACGTCGACTGGCGAGGGCGTCGGAGTCGGCTGAGTTGGAAGGTCCGTCAAATCGGGAATGAGGTCTCCTTCACCCAGCACCACTGTATCAGCGCTAC
TTACTATAGAATCCAGGCTAGACATGCCCTCCTCCAGCCGCATATCACCATCACTATCCGGATCTAAATCATCTTCTGCAACATCTGTCAGAAATGTGGT
GCTGGCAATATCTCCTATGAGTACAGAGTCCGTGCCATCCACATGAATACTGCCGTCTGTTTCTGGATCCGAGCTCTCTGCGCGCGAGGATCTTCACAGC
TATCCGTGTGAGTGCTTGGTAAAACACGGTCTGCAGCTGTGCGTCTGCGACGTGGCCGAACAAACTGGCGACGGCGACTATCAGCACCAGGGCATGGTAG
GCCTGCATGGATGCAGGCAGCCACAATGTGGCAGCACATGCCACGCATTCAACTGTAGACACACGTAAATGCCCTGCTGCGAGTGTCGACTACCCATCCC
CCTTCTGGCATCCCTTCAGTTTGCATCCGACGTGCATTCATGGATTTGATGGAGCGCATCAGCTCCTTTCGCTCATCGGCTGTCAACGCACCGGCTCTTT
GATTGACGACGTAAAAATCCGCGGATAAGTCGCCGACCGGAGGGATGCGCCGTACGGATAGCCAGCCACGACTGTTCATAAATCGATAAAGCTTGAGCGA
TCGGTCGGAAGCGGCAGCGACCGTGTCAAATGGCACGTCTCGATTCTGAAAAGCGAGCTGGGCACCGTTGAGATTGCCGACCAACTCTCGGGGTGTAGCC
AGACCTTCCGCACAGTGCAACTTTAGTGTTCGATGATATTGCTTCAAAGGGTTATTTGAAGCGGCATATCCACCAGGTGTGTAGAACGCCTGCCAGCGGG
AAAACCGGGTCGAGTTTACCCAAAACCATTTCACATGATCTGTGAGTTTACGTACTGAAGAACCGAGACGAAACCTGTCCCATCGCTCCAAAACGCAGGT
CTTTACAGCAGGAAATGCATCTTGAGTCGCATAATGCATGTCGTACAAATCCGCAAACACAACTCGTGTATCTTCTGTGCTCGCACGGAATGTGCGAGCA
TGTTTCCACACATTCTGCGTCACGTGAAACCAGCACATCAAAATGGTTGTACCTGGAAGCTCGGCCGAACAGGCGTTGAACTGCGCATTGCAAGCATCTG
ACATCATGAACTGCGGCGAAAATGGTGCATTACACGCATCCAAACACACGCGCTTCATGAAGCTGATGCACCATCCGACGTCAATTGCGCGCTCTTGAGA
TGTGCAAAAGTAAGCGAGTAAAAAGAACTGGCCGCACCGATCTGAGTATCCAAAGGCGAACACGTTGTAGCCGTTGATCACCATACTGTGGGTGCTGTCA
ACGTGAAATATCGTAGTGCAATCCGACCGATTCTGCACTGCAATGTAGTCACGGACGAGACGTGGACACGTCATGCCAACACGATAAAAAGAATCCTCAG
ATCCGTTTCCGAGATGTGAGACGCTGCTCGCGGTACCTGGCAGATCACTTTGTTGCGCGTCACACAGTATCATCATGTCGCGCTCTGGCAGCGACTGTAG
ATCTAGCTGATCGTACAGATTCCCATCGCAAAGCTGAATCATCGGCGCCATGGAATCTCGTGGGTTACCCCGCCTCCAGGTTTTGACAAAATCAGTCACT
TGAGTGTCTTTCGGAGCAGGATCTGTGATCACACCTGCCTCGACCATGGCGCTGAGAGTTGTAAACAACTTGGTGGCTGTTATTTTGACTCCACTACTTA
GCTTCTCGATAATAAACGTCTTCATTGCAGGGGAAATCTTGCCCTCCGTTGGAGTTGGCGGGTCGTTTCTGTGCATGACATGCTCGACTTGCTGAAACAC
CTCACAGGTGCTAGAGGACAGACAGATCTTCAACTTGTACCGACACGGACATGATGCCGTCTCTGTCGATGTAGCGTCGTCGTCGGGGGCAGTGAGTCTG
GCACGACACCGCTGAGACCGGCACAGTACCATTTGAGACCGCATTTGATGAATGCAGCAAGCTAGATCGAAGTCCTTATCAAATATATGATCCACAGTAC
ACCCCACTGGGTTACTCTTGTCGATACAGTGAGTTGGCAGTGAGTCCCGAAAGGACTGTAGTGTGTTAATCTCCATATGTTGGTCCACGTTGGTCAGCGA
CGCCCTCTTCATCTTTCCGATTCAGACGTCTGTAGCTGCAGAATTCCATCAGAACTGAATAGCAGCTCGCTATCGCGCTCGGACGTTGTTAGTGTTCGCT
ATTGGCTTTGGCAATGCACGCAAGAGGTGAACAGAGAAGCATATATTGAGCTAAATTGCTACAAAAGTCACTTCAACATCTTGAAGTGCTATTTTGGTGT
TTGTCTAGTTTTTTTGCTGGTGGTTTTCTGGCGATTTGGTGGTGCATCCTTTTTTCGAGTGGGCGTGTGCTGCACCTTCGTCCGGTGGTGCAACATCGA