Description :
From Genome Similarity Track
Location :
contig_6:68908- 71517
Transcript NameFunction/comments
g2049.t1hypothetical protein
g2050.t1hypothetical protein

Sequence
2609 bases(100 bases per row)
CTGCATACGCGATTCGACAGCTCGACGCGTAGGCTTTCTCTTGCGGTTCGAGCGGCGTGCACTTCCAATACTGTCGCGCATCACACCACTAGCGACAGGA
GAAACGTCGACTGGCGAGGGCGTCGGAGTCGGCTGAGTTGGAAGGTCCGTCAAATCGGGAATGAGGTCTCCTTCACCCAGCACCACTGTATCAGCGCTAC
TTACTATAGAATCCAGGCTAGACATGCCCTCCTCCAGCCGCATATCACCATCACTATCCGGATCTAAATCATCTTCTGCAACATCTGTCAGAAATGTGGT
GCTGGCAATATCTCCTATGAGTACAGAGTCCGTGCCATCCACATGAATACTGCCGTCTGTTTCTGGATCCGAGCTCTCTGCGCGCGAGGATCTTCACAGC
TATCCGTGTGAGTGCTTGGTAAAACACGGTCTGCAGCTGTGCGTCTGCGACGTGGCCGAACAAACTGGCGACGGCGACTATCAGCACCAGGGCATGGTAG
GCCTGCATGGATGCAGGCAGCCACAATGTGGCAGCACATGCCACGCATTCAACTGTAGACACACGTAAATGCCCTGCTGCGAGTGTCGACTACCCATCCC
CCTTCTGGCATCCCTTCAGTTTGCATCCGACGTGCATTCATGGATTTGATGGAGCGCATCAGCTCCTTTCGCTCATCGGCTGTCTACGTACCGGCTCTTT
GATTGACGACGTAAAGATCCGCGGATAAGTCGCCGACCGGAGGGATGCGCCGTACGAATAGCCAACCACGACTGTTCATAAATCGATAAAGCTCGAGCAA
TCGGTCGGAAGCGGCAGCGACCGTGTCAAATGGCACGTCTCGGTTCAGAAAAGCGAGCCGGGCACCGTTAAGATTGTCGACCAACTCTCGGGGTGTAGCC
AGGCCTTCCGGACACTGCAACTTCAGTGTTCAATGATATTGCTCCAAAGGGTTATTTGAAGCGGCATATCCACCAGGTGTGTAGAACGCCTGCCAGCGGG
AAAACCGGGTCGAGTTTACCCAAAACCTTTTCACATGATCTGTGAGTTTACGTACTGAAGAACCGAGACGAAACCTGTCCCGTCGCTCCAAAACGCAGGC
CTTTACAGAAGGAAATGCATCTTGAGTCGCATAATGCATGTCGTACAAATCCGCAAACACAACTCGCGTATCTTCCGTGCTCACACGGAATTTGCGAGCA
TGTTTCCACACATTCTGCGTCACGTGAAACCAGCACATCAAAATGGTTGTGCCTGGAAGCTCGGCCGAACAGGCGTTGAACTGCGCTTTGCAAGCATCTG
GCATCATGAACTGCGGCGAAAATGGTGCAATGGTGCATTACACGCATCCAAACACACGCGCTTCATGAAGCTGATGCTCCATCCGACGTCAATTGCGCGC
TCTTGAGATGTGCAAAAGTAAGCGAGTAAAAAGAACTGGCCGCACCGATCTGAGTATCCAAAGGCAAACACGTTGTAGCCGTTGACCGCCATACTGTGGG
TGCTGTCAACATGAAAAATCGTAGTGCAATCCGACCGATTCTGCACTGCAATGTAGTCACGGACGAGACGTGGACACGTCATGCCAACACGATAAAAAAA
GAATCCTCAGATCCGTTTCCGAGATGTGAGACGCTGCTCGCGGTACCTGGCAGATCACTTTGTTGCGCGTCACACAGTATCATCATGTCGCGCTCTGGCA
GCGACTGTAGATCTAGCTGATCGTACAGATTCCCATCGCAAAGCTGAATCATCGGCGCCATGGAATCTCGTGGGTTACCCCGCCTCCAGGTTTTGACAAA
ATCAGTCACTTGAGTGTCTTTCGGAGCAGGATCTGTGATCACACCTGCCTCGACCATGGCGCTGAGAGTTGTAAACAACTTGGTGGCTGTTATTTTGACT
CCACTACTTAGCTTCTCGATAATAAACGTCTTCATTGCAGGGGAAATCTTGCCCTCCGTTGGAGTTGGCGGGTCGTTTCTGTGCATGACATGCTCGACTT
GCTGAAACACCTCACAGGTGCTAGAGGACAGACAGATCTTCAACTTGTACCGACACGGACATGATGCCGTCTCTGTCGATGTAGCGTCGTCGTCGGGGGC
AGTGAGTCTGGCACGACACCGCTGAGACCGGCACAGTACCATTTGAGACCGCATTTGATGAATGCAGCAAGCTAGATCGAAGTCCTTATCAAATATATGA
TCCACAGTACACCCCACTGGGTTACTCTTGTCGATACAGTGAGTTGGCAGTGAGTCCCGAAAGGACTGTAGTGTGTTAATCTCCATATGTTGGTCCACGT
TGGTCAGCGACGCCCTCTTCATCTTCCGATTCAGACGTCTGTAGCTGCAGAATTCCATCAGAACTGAATAGCAGCTCGCTATCGCGCTCGGACGTTGTTA
GTGTTCGCTATTGGCTTTGGCAATGCACGCAAGAGGTGAACAGAGAAGCATATATTGAGCTAAATTGCTACAAAAGTCACTTCAACATCTTGAAGTGCTA
TTTTGGTGTTTGTCTAGTTTTTTTGCTGGTGGTTTTCTGGCGATTTGGTGGTGCATCCTTTTTTCGAGTGGGCGTGTGCTGCACCTTCGTCCCGGTGGTG
CAACATCGA