Description :
From Genome Similarity Track
Location :
scaffold_400:6890- 8385
Transcript NameFunction/comments
g8021.t1hypothetical protein

Sequence
1495 bases(100 bases per row)
AATGAACCCAAAGTACGTTCCAGTCCCTACCGCGTTTCAGAGAGCAGGCGAAAGTGAACGCCGCACAAGATTTCCCCGTTCCAGTCGGTCTCACAATCCA
CTGGACTGCACAACTTTTAACAACGCTGGTATTGAGAGCCGCCCACTCCTCTTTAACCTCCGACCGAAGGTATAAACGCAAACCACTTTTATCCACAAGA
AGACCGCTTCCTTGGGCATATTCTTCCGGAATGTGAATGACAGGATGATTCGACTCCTGGAAATTCACAACAGGGCATGGTTTGTCGGACAAATTCCACG
TAGGTGTCAGGAATTGGTCCACAGTTGTCGTAACTAGCCCCAGAGCCACCACCAGCACGTGGATCACTTCCTCGCCGAGCGAAACATTTGGTCCAAAACG
TTTTGTATTGTTCAGCTTCCACGTTGGGCGCATTTGTACAAAAGACAAGGTACAGTTTCCGCTTAGTAGCAGTGCGTCTAGATCCTCGTCGTCTGGCAGC
CACTTGCCGTCCTCCGTCTTCGTCAAATAGAGCTGCAGCGTCTGGGAAGGAACTGTGATTAACCCCTCACTCCTGGTCTTGATCTCCTTCTTCAATTTGG
TCACAGATACATCCTCGTCGGTATCCACCGCGATCGCGCATCCCGCAACGCCAACAATTGCACAGAACAATTTCAGTATTTCCTCAAGGCGGCAGATTCT
GGAATGGGCAAAGAATTATAGAGAACGGATGTCACAATCCTTCAAACCCACAATAAAAAAAGTTTAAACTTACAAAAAATGCGAGTCTCGTCCCAGATAA
CAAGAATATGCTGTTGAATTCATAAGGATTCTCCATGAGGACCTCTACAGGTACGTTGCATCTACCCACCATTGAGACTCGTAGTCTTCGCCCAGGATCG
TGGTGATGTCCACTGCTTTCTTCAATTCCAAGCTGAACTCCACTCTCTCGTCCGTTGCAGCGCCGTCGCCCTTGTTGTTGAACTCCCTGAAGTGGACGTC
GTTGGTGCTAGACGCAGCGTCCCACGCAGACCACCCGAGCGGGTTGATGACGTCGCTCAGCTCACTGTTCTGCCAAACTACGCGAGCAAACGGACGCCAG
GGGCGACCAAGGTACGACGAGCCTTTGGGGTTGGAACCGTACACACGTGCGTTGTTGAACACGTAGTAGGACGGGTTTTCTTCAGTAGAGCGGCCATTAG
CAGTGATGCAGCCCTTGCCGATCGTCTCGATGTCGCAGCTCTCGAACCAGGCCGTCGCCTTGGAGCCGAACACGAAGTCCACAGCGCCGCTAATGTACGA
CTGGGCATACAACTGACGGCCCTTGTTAGCGTACAACGTGTCCTGGTAACCGGTAAAGTTGCAGCCGTAAAAGCCGTAGTCGGTACCGTCGACCGTAGCC
GCCACAGCTTGACCGACGTTGCCGGCAGTATTGGCGATGTTGAGGTTGTACACTGTGACGTTGCTGGCCTTGAATCGCATCGTACTGGTCAAGTC