Description :
From Genome Similarity Track
Location :
Scaffold_43:689- 6184
Transcript NameFunction/comments
Phymu_g2373hypothetical protein PHYSODRAFT_332764
Phymu_g2374hypothetical protein

Sequence
5495 bases(100 bases per row)
GCCTGTCCCAACCTGTTTGGGTCTTATTCTTCAGTATAACTCAGGAATATTACGACAATACTCGATAAGACTGGCTCGAGTGACAACACCATCATCTAGC
CTGCAGTTGTCAAAGAACCCTATGACATGATCTTCGTACGGTTTTTGTTTTCTTGGAGCGCCGCCGCCTTTCCGTCTGTAGACGGTAGGGAATTCACTTG
GTTCTTTAATATGGCTGAGGCTGGAATCCGAGAGTTTGTTTGCCAACCCAACAATGTCACGATGTTAACATTCAACTTGACAGCAGCCTCTGTAGGTGTC
CAGTGCTTGTTTTCTTGCCAGATCTTGAGCAACCTGATTTGTTCTTCGACTGGGTACTGCACACAGCGACGCTTTGCTCCTTCAGCTACAACAGATGCTT
CAGTAGTGTCGGGTATATCTTGGCGCTTGGGCATGGCCTCAATCGCTTGGGGGGGTCGTGAGACTTAGGCAAATGAGGGGGAAATTTATGGCTGTCATTG
CCCAAACCTGAGTCTGATTCCACTCGGTTAATTACGACTAATATTCGAGTAATTTGTGGATCCGTTCGAGTAATTATGTATCCATTTGAGTAATTGTGGA
TCCATTCGAGTAATTGTGGACCCTTTCTAGCTTTCCaagctaccggtagtagCGCTTGATCTGTCTGGGAACATGATTACCAGTACAGCTATAACTAGCA
GTATCATTACCGCTATTCAATTAAATGTTTGTTATTCAACTATTTCGTATTCAAAACTACTAGAACGGATTCAAAACTACTCGAACGGATACACAATTAC
TCGATTGGTTCCATGATTACCTGGATGACGTCCGACATACTCTTAGAAACACACCCAAATTGATCGTTATTCACTTTGGTATTAGGAACGGTTCTTCGTA
TATCGTTTACATAACACGAATGATAGTGGAGATCTAGTCAATAACTCCTATCGAATAATATGTTATAGAACACTTCCGTCAACAAAACCTAATCGACACG
CATTTACCGTTATTCCTAGTTTTGTGGGAGGTTGATCTGCTTCAGGTGACTAGGGACAGCGTCACACACTCTTCCAACTTTTACGCGAGCAGCAAACGCC
TTGATATGCGATTCAAGTTTTCCTTCGCCATGCAATTTTCGAAGGTGCTTCAAAACCGAGATCCATACTTTCGCTTGATGCCGTGCTCTCAAAAGAATTG
CTACAGGTTCGACTCGGCTTCGCAACCAACGCGTAGAACGTCATCGGAGTATGTACTGACCAACGGGTCAAGCGAAAAGCCATTTAGGAGAAACAGCTTC
ATGTAGTTTGTGGTCTACTTGTAAGCCGACTCCTTTTGGCGTGAATCACAAACGTCCCAAATCCGAGGCGTGCTATCATATCACTCAAACCACACTTCCG
CTGGTGACTTTGATGCAGCCCGTGGCCCACACGACTTCATCTTGATGGTGTCTGGAGGTTGCAACTCCGGATTTACAGGTCCAGTACTCTCCTTTGGTGC
ACTTGCACCAGCTTCAATACTGGCAAGTCGTTCCTCCATTTCGCTTAGTCGTTTTATTAGATCTTGATTCGCAGAAACCAGTTCACCACTCACACAGTTT
TGGTGATTGATAAGTCTCTCCTCCTTTGTCATTTCAGAAGGGTCGTCCATGCTCTTGCCTCGTTCTTTGCCGGTGACAGCCTGTTACAACTCTGTCCTCC
AAGCCAGAATCTGTGCTTTCGGGATTCCAAGCGCAAATAGACATTCTCGCATTCGATTGGCGTAAGGACACATCGGGTATTGGTCAAATACCTCCGGGAG
TGTTAAGGGTGTTCATTAACTTATACCGCTTAAAGATGTTACTAAGTGTTTCTATCTTGAACTAGTGGTTACCAGTCTCCTGGCTAAGCTTACCCATAGG
AGTAGGAGGGGGGACTTGGTCGATGTGCGATACCTTGAGAGGTGGCTTAGGTGGGGGGAAGTCAATCTTGGGGAGACCGTTAGGCTCGAGTTGGGCTGTA
AAGCGTGGCCTGAGCGTAGGCGCGAATTTGACGGCACTTGCGAATGGCGCGATCGGGAAACTGGTGTACGAGGTTCAAACCCTCGAGTGTCGGACGTAGG
CGAGACTTCGGGACTGTGTGACGCCATCGTGCTATGCATGGATTTGAGGAGTAGCTGGTACGGGGACTGTGCGAATGATGATGAGATTCCTGTCCTGGAG
AGAAGAGGGGGACCATCGAGCGCGGGCCGGCGAAATTGGCCGTCAGGCTGAGTTCGAGTATAGAAACTGCAGGGTTTTGATGAAGGTTGGGGACGGCCCT
CAGCTGCATGTTGGCGATACTTTGGGTCTGAAGTTGATACTTGGCGTTGACAGGAAACTGAGCACCGGAAATTGGCTTGGACTTGTCGCTCGATATGCCT
TTTCGTCTTGGGGGGGAAACCTGGACGTCGAATGAGCGCTAGTGTGTAGGCTGTCGAATGTTTGGGGGGTACGAAGAGGCCTGAGTTGATCTTGGGCGTG
CTGATACCTGAACCTTGTGGACTGCGAAGTCTTGGGCGATGACTGGGGAGTCGAATTTCGATTTCGTGGGAGGTCATTTTCAGGCAGGAACTTCAAAGGC
GTGGGCTTGGGGGGACGTTTACCTTCGACGGCAAAGTCTAGGGAGTCGTGACGGGAGACAATTACAGAGAGCTGAAGTTGTGGTTGCTGCGGATGGAGTC
CTTGGGCTTCGATGTGGCGGCTGGCATTGACGGAGTTACTGCGTGCTAGTCCTTCGGGAATTGGCCGGTAGTGATGATTGAAGTGGTTGGGGTTCCTTCG
GGTTCCTCCTGCTGAAAATGTTGCGTCAATGAAGCGAACGTGTTGCGTGGCGGGGCCTCGTTGGAACTGAACTGCATCGGCTTCGGCTGGAGCGGATCGG
GTCCTGGAGGATGCTGGCGACTGGAGTAGTTGTAACAGGAGGGTTCGGGCAACTGCTTCAGTGAGTACTTGCCGCGGATTCGGCTTGGGTTGAGATACTC
GGGTTGTCTTGTAGCGGGAAAAGCACCTGTCTTCTTGAGGTCGAGTACCTCCGGGAGGCACTGAATTAGAAGGGCTACGAGTACGTCAGCGACGCGATCG
TTCACCCGCTTTTCAGGATCATGAATACTGAGACTCGTTTTAAATAACAAACCCGCGAGAGAGCGAGCTTGACCAAGGGTTGCTGAATCAAGCCACGACA
GCTTTGGAATTGCCGGCTTTATGCTAGCATCCCAACCGCTGAGGACACGAGAGACCTTTTAATCCTCTTTGGTTGTGTTGAAGACATACGCAAAAGCCTT
ATTCGCGGACGCCATATTCCATGACACTCGATCGAAAATCCATTGAGCGCACAGCGCTGGATCACCATTGGCATGttgagcaccaccacgttgAAACGAA
CGCGAGGTGAGATTAGGCATCGGGTTTGCTTTAGCCTGGACTTCCGATGCAGATTTGACAATCCGTTTCACATATGCATGAATTAAACATTATTGGAGGG
CGGATCGGGTTTTTCGGCATGCGATTTCCCGTGTAAAATCATCAAGAGAACCGCTACTCAAGGTCTCAACAAGTGGAATGTCGTTTGGGGCGGAGATAGG
TAGCGAAGTTCCGGGAAATAATTGGGGGGTGTTCAAGTACTTGTGCTGATGGAAATTCTTGCATCACTATAGCCATTGCAAGAGCGTGCAGCGGGCACGT
AATGAAACACGTTTTGTCCAGAAATAGAGACAGACCTTGTTCCTCCGAGGTTTTGACCCGGATCAGTCGAATAAACACGACACATTCAGCACTTACGGAC
ATTCTGCTTTTGGATATAAAGTCGAGGTCAGAAGCACGCCCAAAGGCGTACCACATCAACGCTAGCAATGCGGCACCTTGGTAGTCTTTAGAACTAGAAG
CGTCAACGTAAATCCCGTCCATCAGAATCCGTAGATCCTCCTTGGTACACGCTGGAGCTTTTTTAATCACCCCTCCCTCATTCCGCTTTAAACAATAGCG
CTCCAGCGTTTGAGCCATCTTGAGCAGTTTCTTCTCGATAACAGTGCGGTTCTTTGGGTAGCTATCTAGTAGCCAATTCTTGACGTGTCGATAATAGCTC
ATTACTGAGTTTCGAGCAAGGGGTTTCCCTCCTCTTCCGTCTACAAAGGCCACATAGACGGCAAAACGTTCCATCAACTTCACAAAAGCGCCACCGTCGC
CGTCATTGCCTAGACACGAGGCGATAAAGCTCATGTTGACATCCTCCGATGCTAGGAAACGCTCGAACGCGTTCAAGGAAGTCTTCTGTGCTCTTTTGGA
GTTAACTGAAGCAAGGTCTTGTAGTCCCATGGTGAGTTGCCAGTGTTTTGGTTGGTAAAAGCGCAGATTCGAAAGTGATACGTGGCAAACCAGTGGTTCG
TTTGGGCTGTCCAGATATCACGTGAACCTTGCCGACATTGTACGTCGGCACTACGTCGGCAGAGATGAACCCTGCCGCTAGCGTTGTTGATTGGTTAAAT
TTCCATTTGACTGATATCTAATTGGTAGATATTTGTATTGAACATGTTTTTGGTCATTTAGTCCTATAATTTAATCAAAATATAAATAGTCTGTCGGCAG
CTTAACGTTATTCATCCGTAGCAGCTTCCGGGACAATTGGGGACAGGTTTCGGTCTTGGTGCAGACTAAAATTTAAATTTGATCGCAGCTAATAATCTGT
ACAAAAAACGCCATGTGATTGGACACAGGTCCCACCACTAGCATACCATTTCCGCGCAGTGTCAACTTCTAGTGAAATTATCACCGTTCCGAATCTCCTA
TTACACCCTTACACTTTGGATTTATTTCCATCAATCACTGACTTCCATTCCATCTTTCCATCCAATGATATTTGACACTGATTACGTTTTTAGTAGTGTC
CGGTATGACATCTAACCCTGCCAGCATTGCCCTGTTACCTCCTCTCGTCCGGGCGGTAGACGCCGAATCGCAGACACCGAGGCACAGCAGGCCACCACTC
GTCGCTTCTCAGTATGTCCAAGGCGCCtaaggccaagaaggccgcGCTTCACTATCAGCCGTACCAGGCGCTCGGCGCCCAGTCCAGCGAGGGCGATGAG
CCGTCCATGGACCTGGGCATGTCGGACCTTCCGATGCATCTGGACCCCGTACTCTCGTACGCCTCCGTTTTAACGTCGCAAAAGCTTAGTCTATAGCGTA
TACTGTACTGACGCCTTGTGTGCTGGTCTGTACAGCGGCCTGTCGTCCAACATGAGCCGCAACTTGTGGGACGACTGGAACGAGAACGATGCCAACTTCG
GCATGAAGTTCGACATGTTTACGGATGAAGTCAGCACggccagcaccgccagctccacggccAGTCCGAACCCGAGCATGCACGTGTCCAGTCTCAGCTC
CGTgggcttcgagcagcagcagaacgcgTCCCCCAACACGATGCAAGCGCACGGACACACGCTGGGggaggagctgaagccgCGGGCGAACGTCC