Description :
From Genome Similarity Track
Location :
Scaffold_1643:689- 1910
Transcript NameFunction/comments
Phypl_g13881hypothetical protein

Sequence
1221 bases(100 bases per row)
GTTTGAGCCACCCAAGTCTCATTCCGAACTTTCGTTTGGGGCAGACGCCGACATACTCCCAGGGCATGACAGTACAGTGATCATCCCCGAACCTGCTCTC
CAGTGCAAGCCTCTAGCTGAAAAGCATTACCAGCCCAATCCTCTAGTGCGGTTGCCATGAACGCAATCTCAGTCGTATAATTGTGCAGGGTATTCATACA
ACAGTCAGCGCATCCTTTAAACGGAAAGACCaacttcttgacgaagccGCATAGGAACTATAAAATGTTCTAGACGAACCAGATTCAAAATTGGAAAATG
GACACAACCAGCATATGGTGATTGAGGGTCTGAGTACGACAAGATGGAACTGTCGTGTTTGAGCCCTGAGAAAAAGTGCAAATGCTGTGGACCCCGACCG
ACTCTGTTTTAGATCGCGTTGCGTCAGATGGTGCCACATCCCGAAAACGAGCAGGGCATCCGGGCTTCTCATGGTCATTTTGGGTTGGTTTTGTCTTTCA
CGTTGAAGTTTGAGTGGTAATACTTTCAAAAACTAACCTGTTATCACAATACTTCGATAAGGACAACGTTGACAGTGTTGATTCAACAAAGTTCCCGTGA
GCTTGTTCAGATGCGATACAACAACTTTACGCAGCCTAATCCTGCCAGTTCCGAATTGATATGGAGAGCTTCGGTTTTGCAAACTAATACAAGAGGGTGG
AGTCCCTGTTATCCGACTCTTGGGCAAAACTTGAAGTTAGAAGTCGCAGCCGTGAAAGGACGGAATAACTGGGGTCGATGCTGCTAGAGGCGTGGTTACT
CCAACACAAGAAGAGCGATTCAGAAACAACTTtacgtggtcgtcgtggatGACACTATGTACGAGTTAGAATCCTGGCTTAGTGGAACTGCGCTAAGTCT
CATACAACTGAGTGGATCATTGAACGATCGATCCGATTTTGAGAGTTGGTATGTCGACAACATTGTTCAAATCGCTACTAAGTTATATCCAGATGAATTT
GCCGAATAGATCGATGACTTACAATAATATATTTCTCGATTTTTCGAGTTGACAAAGGTCGACGCGAGGTTTCAGCAACTGAGGAATACACATGAGTTAT
GCGTCACTATCGTTCAGAGCGACAAAAACGAGCTCTTTCCGATTTTATATCAATGGTATGCCTTGTCTGCGTGCTTCCCTTTCGACCGCCACTACCGAGA
CATCATTTTCAGCTACGAAGA