Description :
From Genome Similarity Track
Location :
Scaffold_34:68892- 74130
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011174Protein of unknown function

Sequence
5238 bases(100 bases per row)
TGTAAACACGATGTGTTATTACCCTCATAGGTTTTTAATAGGATTCAAATCAGGAGAAAGCGCTGTCCAGTCTATGGTGGGAATGTTGAGGTCCGCCAGG
AAGTCCTTCGCCGCGCGAGTCCGGTGAATTCTGGCGTTGTCGCGCTGAAATACGTAGTCTCCTCCATTAACACCATTAACAAACTCAAAGAGGTGAGTAG
TAAGCGTCTGTTGGTAGTCAAACGCATCTTGTTTTCCCTCGAGAAAAGCTAGTCGGGTATTTCCAAGCGGCGTCATCCCACCCCACATCATAACGGATCT
ACCACCGGAATGACGGCTCCACGTAATCTTTTTGTTGTTTTGCAAGTCGTGCTAGTAGTACTTGCAATCATCCGGGCCATCCAGGTTGAACTTTTTTTGT
CCAAAAATACCACTCGGCTCCAGTCCGTGCGGAAACGTATCTGGCGCTCAACCCACACTACGCGCACCATCTTGCGGTGGGTGGCCATGCACGAAGACTT
GTTGGCCTTCTCGAACGCAAGGTGGTCACACCGTTGAAGCTCGCGTTGCACCGTGCGGACGCTTGCATCGATATTTAGCTCCTGGTGGAGCTGGTTTGCC
GTGTACTCACCAGTTGCTGCGTATCGTCTCAATCGGGGGCGGTCGTGGATCTTCAGCAGACGTGGTCGTTCGGGGCTTTTCTTGGTCCCATAGCCTTCAG
GGTTCTTTAAAAGCATGCACAACGCTCTTAGAGCGTCCAACAGCTTTGGCGATGTCCCGATTCGACATATTCACGCTCGAATACGCCAAAATCTAGTCTT
GTTGGAGCTTGGCCAATACTGGAGTCTTCGTGTAATGGGCTATACCTAGCCATTACATGAAGGTGCGACTGTGCCCTACTTTAGTGTTGGACACACCACC
TTCGAATCGTACTTTGTGGACAAAGACATGTGCCTTTGCTCGCGCAATGCGCACCCACGTGCGAATGACGTCATTTGATGATGTCACAAGTATCCATGTA
CTAATCGAGTACAGAGTAATGGTTCCTACTTGGGAAACTGTCTGAACGACAAGACCGACGTGTCTCTACCACCTGAAGTGAGTGGCGGAAGCCGATCACT
TCGCAGGGAATCTCCACAAGGACTTCAAGTTCAAGTTTTCAGAAGATCCCTTAGGTTTAATCGCAGCGTACCCAAAGTTTTATTTATCAGATTCATAGCT
TTTATTTTGCATGTGTAAGTTTTACTTGTAAAAAGCTCTGGGAGCCCTTCAGGTTCAATTGTATGTAGCGACAGGAATCACAACCACATTTTAATTCAGT
TGCAAATTTTCCGCGTTTTACTCAAGTCGTCTTCTCTCCCTCCAAGTCGGTAGATCGCTTCCTCGTCGCACAAGCCTGTGTGCCGTGTTTGAGGGACTGT
TTGGAACAGCACCCTCTTACAGTTGGTCAAGGACCGTGCTTTTTGGGGGGTACTGTGTCGAGCTTTCTTCTTCATCATGTGGTGATCTGAAATTGCGGCA
GCCAGTGGAACGAAGTTTAAGTGGTTTTGCCTAAAAGTGAAAGGTTTGTTGATTTGCAACGAAAGTGGCCATTCTGTTTGCTGCTCTCACTAAGCAACCA
CAGTCTTTTTGACGCTCTCAGGGTCCAAGTCAAACCAGCTTGGTCCAGCGACGATTCGAAAGCTCAACCGTTCCGGGCACCCGTTTATCTACCCAGTACT
TGGTGCAGTCTGGCTCATGCAAGCTAGATGCGAATTCCGTGAGACTTACCAGTGGCTGTGTATTGTAACTCTGACGGCCGAGTATGCGGGATTACAGCGG
CTGACATGACAATCTGTATTCGAAATGGAGTAGAGGCTCTTGGCCTCGATCGTTCAGCATACACTCCACATTCGTTGCGCGCGGGAGGGGTCACACATGT
ACAGAGCTGGGCTCGACTCGATGACAATCCAGTTTCATGGCCGTTGGAGCTCCGACACTTTCAAATTTTACATTCGACTTTGTGATGAATCCATGCAGCA
TCTCGTAGCAAACATGGTCAGGCAGTCATCCAAGGATACTACTGTATATACAGCACATACGAGACACGCCAGTCAAAATCTGTAGGGGTATTGCTTCTCC
TCGTCCTTCCTGGACTTGGATCGGATGACAGACCAGTCTTGCATGTCGCTGCATATAATACAGTGTTTTTGCCCCCTAACTACCTGAAGGAGAAATGCAG
AAAGGTGTTGCATGCTGCTACCTGGAGCAAACACCGCGTGAGGGGCAAACATGGTCGTTTTTACGCTTCTATGGAATAAACGCCGTTTTAGTGGGGTGTT
GGCGAGGATCTGCAAATTGTGGCATGCTTGTGTGCGGCCACTATGCATGTGCCCACAAAGTGTTAAAAGAAACGGTGTTGAACTCGTTACCTTTCTTTAA
GAGTGCCATGTTGACTCTTCAAGTGAATGAGTGCCATGATGAATACTTCAGACTGCTTGTTAGTACGCTGCACCAGCTCGGTAGAATTTCATGAACTTCA
GCGCGACAACCTCAGTTCATAACGTCGTCTCGCTCTCACTTGGTCCGTCAGGCAGCAGCACATGGCTGGTCATGAACCTTTGTTGATGATCTAGTTCATA
CGCGACAAGTTCAACCAGTGACACGAAGCGCTTCGCCGACTCCAAGGAGAGGTACTTCTGCTTCATTTGCATCATGACGATTTTTTCCCACGCGGCATCC
AATAGCCTCAAGTTTACGCACCCTTTCGTGTCTTGTTTCTTCAGCCATACCCGAAAGAAGTGCCCCGAATCCAACAACGGTATCCGCGTCTTGTGAGTTG
ACACAACAAATTGCTGCAGGATCGACCATTTGCTACCAATCGACGCGTCACGGCTTGCGTTGCTGCGAGCGAATTCCTCCATTTGGGCCATCACAGCGTC
ACAGGTATCCAACAACCGCTGATCGTACAACCCAAGGTGGATCTGACTCATGCTCATTGTGTTGGCCGCAATTGTAGATAGCTTGTTCGTCTGCTAAATG
AAATGCGCAGGCGGACGTTGACACGAAGGAAGAGCACTTGGTTGGTTAGAGTTGCTTTGCTGCGTACCTTGCAAATTCGGGAATGCTATGATACGTTGCA
GCATCGAGGTAGGGCACACGTTTGTCTGGTTTCTTGAATTCGTCAAGGAATCAATCCTGTGCTCACAGAGCTCCAAACACGTTATTCTTTTGACAGACGG
TGAGGCGCAACGCTTCGACGTATCGTCAAGAAAGAAGGTTTTATGGAAAAGCAGACATATCTATTCATTTACTTACTGGTAACCTCACCAGGACACGTGT
ATGCTCGTCAAATAGCTTGAACGACCTTTTGACCAAACTAAGAAGAATGCGGAATCAGCTTTGTTGGTGGGCTTAGCCCGCACGCATGCATCATGCTTTA
GTTGTTTCTGGCTCCAGGGATCGCACTGCCAGTAGGCACTAACTAGAAGTTGGGGTTTCGGCATCTTGTGCACGGAAAAACACCACACTTCTGGTGAGTA
GCTCGATCTCAAATGCGTGCTTTTTCGCTTCCTTACGTTCTTTGTACTGCTTTCTCCACCGGTGGCTCCTATTTTTGGCTTCGCAACTCGAGACAAACTT
GTTGATAGCAGCAAGCTGGTGGTGAAACTTCGCCGCCCATGACTCCAGCACAAACTTGTCTCGCATACTCTTGTGGCTGATATGCGCATACAAATCGCTG
ATACTAATCAGCAGTTTGGTGACGTATGTTGGATTCTTCTGGTGCTGGTAGATTTGGTGAATTGAAGCTCCGAATGCGGTAACAGTGTCTTGGGTCGTCA
CGACGATTTTGATGGATCGGTTCGAAAAGAAATCATGGTCGGGCAGTCCGTCGAGCACAAGCAGCGTTTGTTGAACTTCACTCGGATTCATGCTTGTGTT
GACCTCTTGACTTCAAGGCAAATGAAGAAGTGAGACTGGACTTTGTCTAGCAGTTTGCCTCTGAAACAAGCAGCTTAGAGATGGTCAAGCGGATCCAAGA
GTGAGTGAGAAATGATCTTCATGAAATTTGTTTTACTTTCATCCCCGCTACAGCCGAAGCTGCACTGTACCCTTTTTTAAGAAGAGATCTTACAAACATT
TAGAGGATGGGTTCAATGCTTGCTCTTACTGTATACTGAACTCGCTTGCTGTAAGGTGCATCTACGCTTTGATGTACTGACGATAAAGAATCGTTACACT
TCCAGCGCAAAGGAAACCTATCTCCTAGGATCGTTCACCAGCATTAGCAGGCTATGCGATCGTGCTTTCTGCTACGCGGGCCTTGTCCACTGTGAGTCAG
TGGTAATTTGCCGCTTTCATAGGTTGGAATAAAGTGCATTTTGAGTCAGTGACATAGGTGGAATGGGAGAACGTTGTGTGTTTACAACAGCCAAGCTGAA
GCTGGTGCAGCCGGTGACAAAGAAGTTGCAAGGAGAGCTTTTCTCGATTGTTGATTTCCCTGCCGGAAGTCGAGTGAACACAATCAAGTATTCTGGTCCA
CCTGAGTTGATACTGTTGTTCGTAATAACAAATTGAAGCAAGCGAACTTCACTTGACGATAAACGCTTCACAGGACATCCATACCATGCGATCTCCCTTG
AAATGGATGTGAGTAAGCTACAGTGGAGTCTACAGTATTGAACGTGTACCCATGAAACTTACTATTATAGTATCAGCAACAAGATCAGAAGAGGACATAA
ACAAGCTGATGCGAATAATTTTTTTATTTATGAGAAAGACTATTGTAACCGAATGGAAAATCCTGATATGTGGCTCTTCTAATAGTCCACTATTCGTGTG
CGGAGAGGGATGGTAGCGAGGGGTTTCGTAGCAAATGCACGATGCGAAGGTCGCGAAGCATCAGAGCATGAAGAGTGCGGGGTGCCCCCCCCCAGAGAAA
CCCTTAAGCGAACTCAGTAAGTATATACAGACCAGATCATCCAATCTATTGCCTCCTCCCTTGATGGGGGACAAGCACAGCGCTAGTGCAGTGCGTAGTG
GGGTGAAATACACTTGCAACCGACAGAGTATAGCGAGGGGGAGCACCCTTTATTTGAGTCTGTGGAGATGCTTCGGGGATGCTCCACTTGATCGTGCGAC
TTTTCAATCGGTTTCAGTCGGTTGTATTCAGTTGCAATAATTCGTCAGACGTGTCTAGGAGGATGCTCCATTCGGTCACAATAGCATGTACCCTATTATT
ATTATTATTATTATTATCATGGACTGTCTGCAACGGAT