Description :
From Genome Similarity Track
Location :
Scaffold_1213:6888- 8305
Transcript NameFunction/comments
Phypl_g12774putative polyprotein

Sequence
1417 bases(100 bases per row)
TCCGGGACAGTTGAGCCACAGCTGGAATACCGTTCGTGGCACGCTGTGTTTCAGCGAGAGCGTCCTTGCTAGGGTGTCCATGCGAGCGTGCCAAAGATCC
CACTGGCTGTCCACCTCAGCGTACTGGACAAACCGTGCTTCGTCCTGGTCGCCGTCCAACACGTACGCCTTGCCGACCTTCTTTCCCAGCGCGATGGCGC
TGGTTTTGCCCCAGATGACACATGAGGAACGCTGGAGTTTCACGTTCAATCCGCGTTCCGCGAGCTTCCccaccgacagcagccgTCTGTCGAGTCCTGG
GATGTGCAGAACATTCACCATCTGGATCCGTTTCCGGTTCAAACCGAGCAAGCGTACCGTTCCGCGACCTGCCAcacgcagcttcttgccgtccgcAATC
GTCACTTCGATGCCAGCGTCCAAGTCTGCGTACTCGAGAAGATCGGAACGGTGCGGGGTCATGTGAGCGGTTGCACCACTGTCGATCAACCACCCGTCGA
GGCGTTCCGTACCCACGGCGAAGACCGCATCGTCATCACCGTTCCGGACCGGGCAGTCCCGCTTCATGTGCCCTGGTTGGTTGCACTTAAAACACTTGCA
CTTGAAGCCACCAGCGTTCTTCTTCGGAGCGTTCCACTTGCGACCGTTTCCCTTGCCGCCGTTGAACCGTCCGGCGTTCACCTTGAGCGCGCGTTCCGTG
GCCGCGTCCTTTTTCTCCAACCGTTCGCACTCCTTcaggagcttctccttgaccTCGATGAGTGTGATGTCCTTCGCGTTCTCGACGATGGAAGAGATTA
GCTCGTACTCACTTGGGGGGgggctgctcagcagcaccacgagtTGCCGTGCTTCATCGACTGGATCTCCCATCGTCTGCAGGCCAACGATGAGCTCGCC
AAACGCGTCCAGGTGGTTGGTCATGGTCGAACCGTCCTCTATCTTGAACTCATGAAGACGGCGTATCGTGATACGGTTGCGGAGCGTGGTACGGTTGTAG
AACTCCCGAAGCGTTACCCACGCTTGCATGGCACGCGTCGCGGAACGGATCTTCGtctggtgctggagttccACGCCTTGTGCGATGATACCCAGCGCCT
TCGCGTCGCTCACGAGCCACGCCTCCGTGACCTCATTCTCCGGCTTGATGGCCTCCACATGCCCGAGCAGCCCCTTCCGGGTCACCGTCATGCGCATGTT
GTACTCCCAGTGGAAGTAGTTCCCACTCCCGAGGAGGACTCCGACGCGCTTGGTTGACATCTTGGGCGTTCTTGCAGGCGCGAGGCGTACTTGGTCTTGT
GCAGCGTACCGAGCTGCGGCTGTTAACGTATTGAGATAGTGCTTGCTGCGTAGGATGCAAATGCCGAAGTGAGTAGATTAAAGTTAGTCTATGCGATCTC
TCGAAGCTACCCTCGAt