Description :
From Genome Similarity Track
Location :
contig_24:688739- 700173
Transcript NameFunction/comments
g4667.t1hypothetical protein

Sequence
11434 bases(100 bases per row)
CTCATGTGTTTTGGACCAAGACGAAGCAGGTGATGCTGACAACAATGAAACTCGATCAGCAAGGAAAAATAACGGAGAGCGTATCATGTCTCTGGCTACT
CGGAAGCGTTTAGAAGCGAAGGCAAAGCAAGACGCCCAAACTGGTAATGCCAACCCCACCATTCCAGCGTCACCAGAACGGGCAAGACATGACATTCAGA
AGCCCAGGAAGAAGCCTATCAAGCCCAAGGATACTGCTAGAACGGATGAAGTCGACACTAAAGCCCGTCCTTTGGGTAAACAAGACCCACGGTATCTGGA
GCTGCATGAGATCACCCCACTCATGAATCCAAAGCAAGATCTCAGCAAGATTCTCACCCAACTCCGAAGTGAGGACTGGGAGGCAAACTTTGACGCGATG
AATACAGTTCGTCGGCTAGCCATACACCACGCGGGCATGATTGATCTGAGCAAGGTGCACGGAATTGTCGCTGAGATTTTGAAGCAAGTCCCGAACCTGC
GTTCCTCGGTCTCCAAGAATGCTCTGCTGGCACTTGAGTCGATGTGTTCGGCTTTCAGTCGGGCGATGGACTCGGAGGTGGAAAATATCATTCCTGTGTT
GCTTAAGCGGTGTGCCGATTCCAACACGTTTGTGTGCGAGTCAGCAGTAGCATCACTACACACCGTAGTGCTCAAATGTTCAACGTCGCGCGTAGTATCT
GCGCTGGGAGCTCACGTAAGCACTAAAGCCGTACCAATTCGCCGCGAGGTAGCACGTGGTGTCCACGCAGTCATCGTTTGCCAGGCTGACAGTATCTCGA
CAAGTAAGGACCTGCCTTCAATCCTGCACTTGGTCGGTCGCTGCCTCGAGGACTCTAACAACGAGGTGCGCGACGTTGCAAAACAGTCAGTATTGTATAT
GCACTACGAACAGTGCATGTCAGGCGAGCGAATCAAGAGGCTTCTACCTGCTGCAGCACAGACAAAAGTCGACAGCCTGCTCCGTGGGAAGGGCGGATAC
GTCTCACCAATGGCAATTTTCCACGCACCCACCAGCAGCGTGTCTGAAGTTGTCACTGAGCATTCGGCAGCACTTGCAGCTAAGCAACACGAAACTATCG
CAGCGTCCGCAAGACTAAAGAAAACAGCGAAGCAGCACTCAAGGCGACCGACTCCGCCAACTTCGCGCAACGTAACCCGATCAAACATTAACGCAGATGA
AGTGTCTCGACTTGAGACGAAGCTTGACAGCAGCAACTGGAAAGACCGCTTCGATGCGCTCAATGAAACTACCGATTTCATCCGTGGCAGTGCATCAGCT
CTCGTGGGAAGCAGCCAGATGCTGAGCCTGTTCGACCAGCTCATTAAGCGGCTGGACGACGGCAACGCCAAGGTAAACGTACTAGCTCTCGAGTGCATGG
AGAAAATCGTCCCTGCTGTAGGCACCGGGATGGAGCAGGTGCTGTCGAATTTCGTGCCTGCAATCGCCAAGAACCTTGCCAATGCTCGAACGTCGTCACT
GGCCCAGTCCGTCGTGCAGCAGCTTTGCACACATGCTGACAACCGCTCACTGTGCCAACATTTTGCAATCCAAGCTCGCAACACCAACTCACGTGTGCTT
CCAGTGGTGCTCGATACGCTGGCGCAGCTGACGGCGCAGAGCTGTGACGACAAGAACAACTACGTGCTCAATCGCCACGTACTTCCGTTGGCCCTCGGCC
TGCTGAAAGAAGCCAAAAGCGACGTGAAAGAAGCGAACGCAAAATTACTCTGCCAACTCAGTAGGACATTGGGCCTCGCCACACTGTCATCCGCAGCCTC
CAAACTGAGCTCCTCACAGCAAGACAAACTAGCAGCCATTCTTCGGTGACCAGGATGGCCCATTCATAAACTATGTCAATTACGTTGCATAAGTAATTTT
TGACGCAACATTACAAGTTGCAGCACTATATTACGTTGCTTCAAGCCAGAGTTTGAATTTTGAGCGCCAAGTTGGCCCCTCCGTTCATTCCTCGAAAGAC
GAAAGCAGACATGACGTCTACGCTGGAGAAGCCTCAGATGCAGGACGCGCAGACGCCTGAGCATTCCCAGAAGCAGGACGCGGAGATGCAGGAGCAGCCT
CAAACGCACGACAATGAGCCGCAGGACGAGCAGAGGGAGGAGCAAACGACCACGGAGCAGAACGAGAACAACGGGACGGACGTAGAGACCAATGCCCCAG
TCTTTGACGAGCAGCAAGAAGAAAATAACGAGGAGGAGACTCCGCAGGAGAACGAGACAAACGTTGAGACGCCCGTGGAGACTGCGGACCACGAGGAAGA
CCAGATAGCAGAGACACCACAGGAGAAGAGCGTTGCGACGCCCGCTACTCAAAAGACGGTGACCCAAGTGCCGGCTTCTACGTCTGCAACCAAGAGGAAG
TTTGACGCTCTCCACGCTCGCAACTTGGCGTTGGAACCTTCGATCTCCGAACACGAGAAGAACAAGAAGGCGCGTGCATCGGCACTCATGAAGTCGCCGG
CTACGAAGGTGGCCGAGACGAAATCTGCGACTGCCAGAAAATTTACCAAAACGAGGGAATTTTCTTTTGCCAGACCGACAGCTTCATCTGCGCGCCGTAC
AGCTGCAGCTGCTACTGATCACGCTCGTGCCAAGGCGACGATGACCCTGCCGGGCCGCAAGCCGCTACATGCTAAGAACAACAAGTACACACCTGCCAAA
GCTCAGCGAGCGTCTATGCCAGTTTCCAAGACGTCGGCGATCATGGACAAGGCGTCGCGTCCTCACTTTAACTATACGCCGTACTCGGGCCCACTGCCGG
CGCTGACGGTCGAGTCGAGCTTTGCTCCCAAGAACGTACAGGGTTTGGAGCGTGGAGCGCGTACTGCGTCTCCTGCTAGAGCGAAACCAAGTGCGGCGGT
GAAGAAGGTGCCTTCGTACAGGATGACCGGTAAGGAAAACGTTGGTGTGAACACGAATGGCGGTGCAACTACTAACACAACTTCGAGCAGCAAGACCCAC
CGAACCCCGTCAAATACCGCATGCGATCACCTGTAACCAAGGACATGAACCGCTCCGCGTTCAAGGAAAAGGTCAAGGACCAACGCTTGGTTGCACAACA
AGATGCGAGGGTCACCCCGTTTCAACGAATGCCACACCCGTGGAGATAGCCGGCCGCAACGGAACTTTGTTGTAAGCCCCCCGTATATATCGTGCGCTAT
TCCTATTTGCATGACGTAAATTCGCTCTCCATTTCGTCTATCTTCAACAGCACGGGCGCCAAGTAATGAAAAGTGTTGTCGTTCTCTATTCTTAGCGTCG
ACGCTAATTCTCCGTCCCGTGCTATTGCTTCTATCAGACAACCAAGAATTCCTTCATCACAGCGCTGAAGTGTGGTCATGGCACGAGTAGTGTCGCCGTT
GCCTCCAAGAAACTGGCTTCGCCACCAGGTAGAACGACGAGTTCCACCCGCACGCTCAGTTACCACCTCAAGGACGACCACCAGCGTGCGCAGTGTGTAT
GATACTGCTCTGCACATTGATGATCAGACTGCGAGCCTTCACACCGACGAACGTGGCGACAAATCAGCAAGGGCAGGCATGTTCAAGCGCAATGGCACCA
ATCGCGAGTCTTTTTCTCGGTTTTGCTGCTGGTTCTTGTCGTATGCCTGAGCTGGACGTGTTGGCTGCTACTGCTCGCGGTAGCTCCCAACGAGGCGATC
AACTACGTCATGAGGACCACGGATCTAGACAATGGCTCGTTTTGGATGCTGGTGGAGCCAACACCTACACTTCGAGCACTAAGTCTCATTGGCCTGTCGA
TTGTGGCCATAGGATACCTCTACGTCGGTGCCATGCTCCTTGCCTCGGAAAAGGAAAGGACCACACAGTGCGGACCATCAATGCAGAGTCAAGACCAACG
AAAGCAAGCTCAATCACGGAGAGGCAGTGTAACACGTACTACGAGCTCTGTATCTTCAATCTACCCGCTCCCATCGCTATCCGGAAGAGAAGATGCACAA
CTTCCGAAGATCGGATGTTCATCCAATTTGGGTATCGACGTTTACAATTTTTGTTTGAACGTGTGGTGCAATCACAGCGATGCTCGGAAAATTGCGGTGA
GTGAACTTGTACTGGGTGGTGCTTGGAGGAACTTATATTAACTTTGGTGTGTGTAGCATGTCTGGGTAAAAGTTGGGGATTTGATGCTTCAAATATTCAT
GTTGTACCAAACACTTGAAGCAGGTTACCCATTGCCTCTCGTCGTAGTCTGCACCTGGATAGTGGTGTGGAATGCATTCGCAGTCGTCGTGCTCATGCAC
TCGCCCTCGCCTCCGTCTCAAATTGGTGAAGCTATCGTTGACGCGATGTAAGTGTTCATGCGCTATACTAACTACTGTATGCAAACAACGAACTAAAATG
TGTCCACGTGCAGCTCAGACTTGCTTGTATCAGTCGGCTTCCCGGTGCTGGTTCTCATTTACTGTCTCGAAACCTTTGAGTTTGATCGCGAGAGCCAACG
CCTTGCGGTCGACCTCTTTTCTCCCTGGTCCTTCCAGAATGCTGCGCGCGTACATGCAAATCCAGAGCAAACAGCGAAAATTTACAAGAGCCTGGAAGGT
CTTCGCTTTCAGTCGGTTGGCGTTTGCATTGCTCGCTTAGGCAACAACCTCGCACTGTTGATAAGTCTTCGGCGTCTGGTCAAATTGCTGCGAGCTCCAG
TTTCGTCAATGTCAATGTGTGACGTGGAAACAAATATGAAGAGCAGTATTTATCCACGGAAACACCCACTGCTTTGCTACTTGTAGCAATCGCCATGGGC
ACTATCGTTTTTGTGGCGGAGAGCGTACACCACTCGGACCAAGCTTGTAAATCATATCCTACCTGCACAATGCACGCCCACCGCTGGTGGCTCTCCAGCC
GAGACGAGTCGACCAACCCCGAGACCAGCAATGCAAACTGGAATTGCCCTTGCCGTGTACTAATTGATGTGGATCTCTCCCCGTCAAGTTTCTCAGCGTG
GAAGGATCCTCCCGATGCTACCGATACTGTGTCTAGTCTCGCTGCTTCAGGTGATTTGGAAATCTTACAAATAATCAATCGTCAGCTACCTCAGCTACCA
GAGACACTGCGCCGATGCAACCGTCTCAAACACATGTACGTGAATGTCATGTCGACTACAAGTCATCTCAACCTAACGCTTACGTTTTTATTTCTCCAGC
GCATTGGTATTCACACACACGACGCATTGCCATTGTGGGCTGCCGAGTTTACAGATCTGGATTCTTGCACATTGAGGGCAAGTCCGGACTTTGAGCCTTG
CTTCATTACCTCAAGGTTTTCAGCATGATGAAAAAGCTCACGTTTTTGCATCTGGGAGATCACTCAACGTTGGCCAAACTTCCGGATGTTGCTGGTCTTA
CCAACCTCAGGTCGATCACGATGGCAAAACTGGAGGCACTCGATTCGTTGCCTGCAGATTTCGCGCAATTGGATCGACTAGAAATTGTGCTTGCACTCAT
GGTGTCAAAGTTGAAGACATTTCCAGATCTCTCTCGGACTCGGCAAACGCTTAAAGCCTTGGTGATTGACGTTTGTCCTCTATGCTGCGACGGGTTCTTA
CAACTTGTGATTTAACGAGCAGCACCTGTGGCCTTCACGATCCAGGACAAGATGATCCAAACGTGCTTACCGGTAGGGCTTTCCGCTACTTCAGGACGCT
TAAGCTTTCCGGACGTTCAATCGACAATATGTGTGAATCCACCAAGCCCACCACTCGTGTGCAAGACAACCCCGCAAGACAGCGGTCCAGCTGTTCTGGT
GCACCAGGTTCAGATCTCGACGGAGCTTTAGAACGAAGTATGCAGCACTGTGGAGGAACCTTTTCGCGAGTGTAATCAGACGCCGGAATCAAGCTCTGGA
ATATGCCTAGCGACCGTACATGCCAATTTGTGTCTTGGGATCCCATACTATCAAATGGCGACGCCTGCAATTGAGCGACACGTCGGACCAGCGTGCAACC
CCACGTACGAGGCATGGCTGGGCTGCAGACCCTGATCGAAGCATACCTACTGGAATTCGAAATCAAATAAAGATACATGTGAATCGAAATGCAGCCACCT
GGGCACTCCTTAAAACTAGTTTGCTAGTATGTCCTTCATCTTCCTGGTGCTGGTGATAAATCTGCCGTGCTCTCCACTCTCCACATCCGAAGTCGACTTT
ACTTGCCAAAAACTCGTCGATGTAGGCCGCAACCTTGTCCCCAATGCGGCCCAACGCTTTCGCCTCTTCACCGTTTCTCACGGTCACATCCGCATTGCGC
AGTCGACGAGCAGCGCGCACGAATGCCGTACCCCGACTGATGTGGCCTTATAGAGCTCTTCTTCGCCGTACTTCACTAGTGCGTCCACCAGAACTTGGTT
CGCCTCGACTTGCGCTTGCTTGCTGCAAACATCTTGCACGATTGGAGGCACCACGGAATCCGGCTCACGCTCACCAAACTCGCTGGATTCTTCTTCTTGC
TCTTCATCGTAGTCGTAATCCTCGTCGCTATCTGCATGACCTTGTTGGATGATCTGGTCGATCTTAGCTGAAATGCGCTGCCCCACCATGTCAATCTCCT
TGCTGGCTTGCTGTCCTGACTGCACAATCGTCTTCGCGTCTCGAATGGCTTGGGCTGCCCGCAAGTGTGAAATCCCCTTGCCTCTGTGACCAGAGTACAG
GTGGCTGTCGCCATAGTCGACCAAGGCATCGACGATAGGTTGGTTTTCAGGACAGGTGGCAGGCTTTTCGCGCAAGTCCTTGACAATCGGAGCCAGCGTA
TACCCACCACTACGGCGTGGGTGGGTTCTGGAGCCGGTGGTCTCGCCTGTATCCTGAACAATGCGGCCGTGCGTCAGGATCTGGTCAATCTTGTCGGCAA
TCACATCACCAACCAGCTGCACACTCGTACGAGCCGTCGAACCATTCTTGATAACATGCTCCGCGAGTTGAATCTCTCGCGCTGCACGGAGGTGGGTCGT
TCCTTTACCCGAATTACCAAAGTAAAGTTCGTGTTCCCCGAACTTTGTCAGTTCGTCAACCAAAACTTTGTTTTGAGGACACTTCGTTCGCGACCTGTGA
ATTTCGCGCACAAGCTCCGGCCGCGCATGGTTGGCCACGTTGTCGCTGACGTTCTGCCCAGAAGTAGCATCCTTCAGTTTCCCCGTCGCCAGCACTTCTT
CGATCTGGGAGGCAAGCTTCTCTCCAACCATGGGCACGGCTCGGGCATCTTTCGCCGACGCAATGGCATCTGGGTGGTTCCGAATGTGAATTGCGGCGCG
CAAATGCGAGACCCCTTGCCCGTGTGTCCGTGGTTCAGTTGGTCCTCGCCATAGTCGGTGAAAGCATCCACAATCTTCTGGTTAGCCGCGTTTGCAGCCT
TCTTCTCGCGAGCTTCTTCGACCAAACGCAAGGCTTTGTGGGGAGCGATGGGTTCTTCATCATCGCCATCAAGCTCATACGCATAACCAATAGTGCCCGG
GTCGTTGTCATCACCCCCATTCTCATCACGCTTGCTCTTCTTCGAGCTTTTGTTCGACTCCGCAGGTAGCCCACGCTTGGTCCGGCCGAACTTGGCAATT
AACTTCTTCAAAGCACTCTGTGAAAAGGACCCAAGTCGAAATGTACATTAAGAGGATCGTTCTCAGCAAGCTGCATTGGTAAATATGTACCTGCTCGTCT
CCGTTAGAGGCAAGTAGAGCCTTTGAAATCTCACTGGTAGCCGCATAAGTGTTCTACACATCGACAACAGCGAGTTAGTCGAGTGCATTCCTCTGGAAAG
TGAAAATGTGGATTTTGCTAACCAACCTCTGGGATATTGACGCGGTTACTCTTGCAGGCCTCGCGCATCTTCCCGATATGCGCGTGAACTGCATCGGCAG
TCGTTGCGTCGGTCATCGTCACTTTGGCAAGAGCGGTATCAATGCGTGCGCTGGTTTCTCGAAAAAGGAGAATGAGAAGTGGGGATCGATCCGAAAATCT
TGGCGAATTGATGCCACAGTTAGCTCACATCTTCAAGCGGGACAGGAGGATTCCTCAAATGGCACACGGGAGAAACTTGAACAAGAAAAGAAGTGAGACG
TGGGCCTACCAACTGAAATTGCTTGAGGCCGCCGCCTTCGCAAACAGTAAACTGCTACCAATAAACGTCGAGTTGCATCACTACCTGGACCGCTTTGACG
ACTGCGCGATCACGGAGTCGATAAACGGTTCGACCTTATTTCCCTTGCACAGCCCAGAGCGCTTGCCACGCTCCCGTTTGTCACCAACTCGGCAGCATCA
CACGGAGGTGGCGTGCAGTACCTGGACCAGTGTGTCACTTAGCGAGTTGCTTCGCAGTGATCGCGTCTACCAACTGGTTCCCCTCGACATGAAATGGCTT
GCTTCGCAGATCGTAGACAATCGGTGCTGTGTCGGAAGGTCCGCGAGCTCCGAATTCGCTGCCTTCCTCATGGTCATCGTCGCCTTCATCATCATCTTCG
ATGTCAGCGTGACCGTGCTCCAGAATCTGGTCGATCTTGGCTCTCACTCGAACACCAACATAATTGATCGACCCCACTGCTTGTTTGCCTGATGTCACCA
CTACGTCTGCGAATGGCTTTTGCAGCACAAGCGTGTTGATCCGCAGAGTTTGTGTATCAGTAGCTCTCCCGCTGGAACTTCGCAGCCAGACAACTCCGAG
CGCGCTGTTGATAAACACACATGACATGAATATCTGAAGAGCTCTCATCGGACAGGTTCCAGTAAATGACCTCTTCATCTCCGTCAGAGGCTGATAGCGC
TGACGAGATGGCAGAAGAAGCGTTGTAAGCATTCTGCAAGACACCGGAGGTCAGCTACAATTTCGTGCTGCACAACGGAGCACCAACTAGTAGACCAACC
TCAGGAAGAAGAATCCCGCTTCGTCTGCAGGCGTCGCGCAAGTTTCCCAGGTGCTGGTACATTCTGGTAAACTCGTTCAGCCAGGATTCGCAAACCGGGA
CAGGAGTCTTCTTCAATTTCTGCGCCATTGAAGCCCTTTCTCGCCCAGCAACGTGACCCAACTCTCAGCAGCACAGCCATTTCTCCAAGCGATGGAAACT
ACAACTGTGGACGACGCCTTCGCGCAATTCAGTGGCATCGGGACGGCGTATCTTCGAGCCCTCGAGAGTACCCGTGCTGACCGCCTCATTAATGATCCTT
TTGCGGACGTGCTAACGCGTGACAGCCGGGGGAGCTAGAACAGCGTCTATCTACTGACCCAGACTCTCTGTGGGTAGATATGGCTGCGATTCGTACTCGA
TACGTGAATGAAGCGCTGGCACACCGCGACGCTACCATCCACCAAATTGTTTTTCTCGGCGCAGGCTTGGACACTCGAGCGTATTACTTGGAGTCTCTGC
GTGACTGCCATGTGCTGGAGATCGACCAAGGTTCGCAGCCGTTTGATCGCAAGAGGGAGGTGATGAAAGCTGAACAAGTGCTGCCGATTACGAAGAAGCT
TGACTACATCGTAGCTCATCTTGCTGAAGACGACTGGGACAGCAAGCTGCGTGGGCATGGATTTGACCCACGTGTGGCCACGTTCTGGGTGATGGAAGGA
CTGCTTCCCTACATGGAGCGCTCCGCCATTTGGACGTTGCTCGATACGATCGATGCGATGTCTGCTCCCGGCAGTACGCTTTGGGCCGATATGGCTGGCC
AAGCCATCTTCACTTTCGCAGATATGGGCGATCGCGCGATGAAGCATAGCGAGGATGATCCTATGCGTGGCGTTTTGAGCCAGATTCCTTGGTGCTTGAA
GTTGCAGGCGTCACTGGTGAATGCTGGGACGCATTTTGGCCGTCGTGGCCACCGCTGGCTTCCACGGACGGCAAAAGGAGTGTCCCCATTCCAATCTCAT
TTCTCATCGGCCAGAAGCCTGTTCCAACGGAGGCTCGTGAGAAGGATGTGTGCCCCGGCCTGGAAGCGTAGGAAATAGCCAAGAAGACCCACCCACGTAG
TTAGTTGAAGCTTTTGGTCAGCTACAATCATGCTGGCTGCTCGATGAGAATATGAGAACGGGCGACGCCCACTTTCTTAGCAAAGCGCCACAACATTTTC
TTCTTGCTTGCCCGCAGAGCGATATCAACAGCGAGTTATGGATCCTCAGTTATTCCAAGTGAGCGCCTCGCAGTGGATGATACCTTTGCAGAGTCCATGG
GATTCGTGACGACGTACCTTCGAGGGTGGAGAGTGCTCGTAAGAACCGCCTAATCAATGACCCCTTCGCCGAGCCACTTACCCGAAAGCAGCAACAGAAT
ATTGAGAAGGTTTTGAAGGAGGTGTCGAGCTTTTTGCATGCTGTCCCAGTTGACGGTGTCGCGTTTCGCACGCGCTATCTGGACGAAGCGCTCTGTCACC
GCGATCCCCGGATCCTCCAAATTGTGATCCTTGGCGCTGGACTGGATGCTCGTGCGTACCGTTTGGAGTCACTCCGCGGCTGCCATGTTCTGGAAGTCGA
CCAAAGCGAGAACGTGTTCGAGCACAAGGCTCAAGTGATGAAGGAACTACACGCACCACTGATTGCTCAAAGTGTTGACTGCATCGTCGCCAATCTAGCT
CAGGCTGGACTGGAAGTCAACCTGATGGGGCACGGATTCAATCCGACCATGCCGACTTTCTGGGTCATGGAGGGGTTGATCCCCTACATGGAGCGCTCGA
GGATCGTGGAACTACTGAAAACCATTGATTATCTCTCGGCTCCTGGAAGTGAATTTTGGACGGATATACCCGGTCGTATTCTTACCGATGCTGAAGAGTG
GGAAAACCGCTGCATGAAGTACGGCGAGGACGACCCGTTGCATGGAGTTCTGAGCGAGATTCCTTGGACTCTTGAGCTTCAAGCATCGCTCAAGACTGCT
GGAGACCACTTCGGTCGTCACTGGACCCCCATCCTCTCCACCAAGAGCAAGCAGACAGCTCCGTTGTTCTTCATCGTCGGCAAGAAACCGATTCCCAGTG
TGGTGGTGGAGCAGAAGATGTGCCCCGGGCTCGATTTTGAGGCCTAGTTGGGCAGTAACGCCCTTCGTTATACCATTTCCTTTGAATCAATACTTGCAGT
CGTGAGTTGCAAGAATGAAGCATTTGCCATTTGCTCTGACCATTCACTTTCGGCCTTTTCCTTCAACTTCCTGCTCGTCAAATCAGCAGCGCATATCCCA
ACTTGTGATCTGCACTGCATACAAAGTGACTGGTGCTGGCAAAGCATTATCAAGGTCATCAAGGAAACGTTATACAATCATCATGCGTTGTCACCAACTT
CAGTGCTTATTGGCGCGAGGATAGCGCTGAAAAAGTGCAATCGGCGTCGATCCGGAGTGCCCAATATCCTCGGACACAAGCAAGCCACTTGGCTGGAACC
TCATCAACGTCACTTCCTCTTATTCCCTGAGGGA