Description :
From Genome Similarity Track
Location :
Scaffold_111:68872- 75385
Sequence
6513 bases(100 bases per row)
GAATAGGAGGGGCACTTGGGTCAATGATTTGGCTGCAAAAAAACTAACTTGATCTCTCTGACCATTTGAAATTTGCACGTCAGTGTCACTAAAACATGAT
CTTTAGAAAGCACAGTCGAACCGTTCTTGTAAATCTACGAGGGTGTCGAAGTACACAAGATGTAAGATAGTAGAAGTGAAAAAGTTGCTGTCAAGATGAT
TTAAGATACTGACATCGGTAGCAGATTACTGTACAACTTCGTGGATTTTAAACATGAAGCCCTGTTTGTTGTTTTTCACTCAAGCGATTGATGCTGAATG
TAGAGCATAAATGTGACCTACTGATGCGCTAGGTTATCGACACTACTCAGTGTTGAATAACACGGCTCTGCACAGCTTAAGAGTGATGACGAACCGCATG
GACGGCTCAACTGAACCGCATGAACGTTCTTCTGAATGGCTGAACGGCCATGGCGGAGAGAAGACGATTCGAGAAAGGAAAGGTAGACATAGAGTTCAAC
AGAGAGTAGTTTAGGTAACTTAAATCTAACCACTTCGGTTTTTTCCTCCAACTACATAAATAGGTTAACAGTCGCAGCTCCGACCGCTCCATCAAGACCA
AGTAGACCTTGCCTCACCCGCAACGCTCATGAGGAGTACCAAGCGCGCCGAATTCCATCTGGGAAGTGAAAACTACTTCCACTGACATTCTAGTTTGAGG
ATGGCGCTCGCAAGGTAAAGACTGCTGGCGCACGTGAAATTGTTCAAGGCGGAGAGCTAAATAATGGAAGCCTGGCTTATGAACGATACGGAAGCTCTCA
GTATAATCGCGCAGGGTGTAACCTACGACATCAGACAAAGATACGTTCCTCAACGCGTGCGATTCAAGCGTGGGTGACGCTGAGGGAGTTCTGCAATCGC
ATTACACTTCACAATCGGGTCACGATGACACGGCGCCTTCACAAGTTCAAGATGGTTGGCGGAACGATCATGGCGAAGCATTTGTACGCCTTCGAAGTGC
TCGTTGTCGGGCTTCGGACGCTTGGAGAGCCTGTCGACGAAGCACGGCAGCTCGTAGTGCTACTGATCAGCCTTCCTGCCGAGTACGAGCTGATCTCGTT
TATCATCGAGAACGCCAAGGACATCACGCACATCGAGGTGGAGGAAAAACTGCTGAAGGAGTGTGCACGGTTGGAGAAGATAAAAACAAAACCTGAACGA
GTGTTCGAGGTCAACACTGGACGGTTCAAGGGCAACAAAGGGAGCAGTCGCAAGTGGGGCGTTCAAAAGAAGAATGCCGATGGCTTCCAAGGCAATTGTT
TCAAGTGCCACAAAATTTGGCATATGAAGCGAGACTGCCAAGAACGCTTCACGGACGGCGATAATGATGCGGTGTTTGCTGTAATCACGGAACGCTTTAA
CGGCTGGTTGATCTATAGTGGCGCGACCTCCCACATGACCCCACACCATTCCGATCTGCTCGAGTATGAAGACGTGAGAGATGGCATCGAAGGAACGGTC
GCTGACGAGAAGAAGCTGCAGGTCACTGGCCGTGGTACATTACGCTTGCTCGGACTGGACGGCAAACGGATCTAGATGGTTGAAGTTCTTCAAACCCCGG
GTCCCGATCGGCGTCTGTTGTCAGTGGGGAAGCTCGCGGACCGTGTCTAAACGTGGAGTTCCAGCGTTCCTCATGTGTTATCTGAGGAAAGGTTAATGCA
ATTGCAATAGGCAAGAAGGTAGACAAGGCGTACGTGTTAGTTTTGTGTGCAAGACGAAGCTCGATCTGCCAGTACGTCGGGGCTGACAGCAAGTGGGAGC
TTTGGCACGTCCGCATGGGGTTCCCAACCAGGACACTCTGACTAATACACAGCATACCAGGAACAGTATTCCGGCTGTTGGTCAACTGTCCCAGTATTGG
TGCGGCGGATGCATGAAAGGGAATCAGACGGTAGCTACGTTTCCGCACTAATCCAGCATAAAGACGTCACACGTTCTAGAGCTCGTCCACACGAATGTGA
TAAGACCCATGAAGAAGCCTTGAAAAGGTGGTGCCAAGTATGTCCTGACGTTCGTGGGCGACTATTCGCGCGACGGGGTGGCCTATTTTTTGAAGTGGAA
GGGTGAAGCGGCCGCCAAGCTAAGAGAGTACAAGACGTTCTATGAGAATCAATGGGGAGAACGTATTAAGTACTTACGATCGGATAATCGAACGGAGTTT
GTGAACCAAGTGATGACGAAGATTAATACTCTGAACGGTATCGTGCACCTACGGACCGTCCCGTATAGCCCTCAGCAGAATAGAGTGGCAGAACGGATGA
ACCATACCATCATGGAGAAATCTCGAAGTGGGCTACACTACAAGGGCGTTCCAACGGATTGGTGGGATGAAGCAGTGAGTACTGCAATATATCTGATCAA
CCGTTACACGATCACGCAAAACGCAACCGTGACACTGTTTGAGCTGGATTTCAAATTGGATCCTCAGATAGATCATCGTCGCGTAATTGATTTCCGTGGA
TACGCTCAAATCTACAAGTCGAAGAAAAAGAAGACTGAACATAAGAGATTTAGGTGCCTGCTACTCGGATACCCAGAAAACGTCAAACGTCACCGTGTCT
ATAACTTGGATGCTTCCAAGGTTAAGGTGTCCTGCTTTGTGAAGTTGTACGAGCGTGGTCTGGACGGTATCTATGATACAAAATGGCTCAGAACGGAACG
TTCATGCACGTTACCATGGACGCCGATGCAGCAGACACGCTCGCTTCAGTGGAACGCCAACACTTCGTAGCGAAACCCAGGTAACGTTGTTGAGAACGAC
GCATTGGACGTAGAGATGGGGAGCATGCAACAAGAACATGACGCTATACCGCCGCTGTTGATGCCAAAAGAATGATCAGCTCCTCCTGGACTTGAATCTG
AACCGTACTGTGGACCACAAACTCTATCCTAAGACTATCGATTAGGGTTCCACATTTGTTGAACCGTTCAAGACGTTCCCTCAAACTAGCGTTTCTTCAT
TGAAGAAGGTATGGATGCCGAGTAAGAACGGAAGTTGGAAGGAAGTGATGGGCCGCCCTCTACGAAGTGTGCCAGGATCGATGAGAACTGTCCTATCGCG
GAAGCATTCTCGCGTACGCTGCAAGCATTGACGCAGTGGATCTTCCGACAACGTACGCTCAGGCATTTCCAGTTAAGATGCTATACAATGGCATGAAGCC
ATGGGTTCGGAACTGCTCTCCCACAAAAGGGACGGTACCCGGACATTAATTTGACGAGGAACAGCTAACCTAAACATTGAGTGCATGGGTTTTCACCAAG
AAGCGTGACCAAAACGACCGCGTGGTGTGCTTTAAAGCACGGTTGGTGACGAAAGGTTTTAAGCAGAAGTACGGAGTGGACTTCTTTGAAACATACTCTC
CAGTGGCGAACATAAATTCGATTCGAGTTGTCCTTTCGGTCTGCGCTGCTTACGATTATCGGATGGAAAAACTGGACGCTGACACAGCGTTCCTCAACAG
TAATTTGGAGGATCGTGTATTCATGGAGGTTCCTCTTGCTATTACGAACGCTCAAACCTATGAGTGTCATCTGAACAAGGCCATCTATGAATTGAAGTAA
GCCACGAGTGCCTGGAACAAGATCATTAATTGTGCGTTCTCGGCAGCGGATAAATAGTTGTGGAGCGTACCAATGGGTAGACGTCAAGCGTTCCAAGATC
TATTTCATTTACGTCTGCCTTACGTCGACGATATGTAATTGCGGCAAAGACTAGTAATGAGATTTGTGACGTGAAGGGCGCGCTCAAGATTGTCTTTAAG
GTGAAAGAGCTTGGACCTGCGAATTTTATCCTGGGAATGGAGATCGACCACGCTACGGCTGCCGGAACGCTAATGATCAAGCAAACGCGGGCTGACGGAA
CGCTAATGATCAAGCAAATGCAGTACATTGATGATGTGACAGAACCGTTTCGACAAGAGAACTCTTAGCCGGTGGACAACCCTTGTACAACCGGTCTAAG
TTGTTAAAGTCGCAATCGTCAGCAACTACTGAAGCCTAGAGCTCGATGCGATCGATACCGTACCGTTCTTTAATTGGATGCCTATTGTACATCACGACGT
GTACTCGCCCGGACATTTCATTCGTGGTAACGAAAATGTCTTGCTTCCTCAAGCATCCCGGCTACAGCATTGGAACGCTGCTGTACGCGTGATATGCTAC
TTGAAGACGACCCGCCAGCATGGGATCAAGGTGGTACCGGTAGCGTCACGGCTGAAGCCTACTCGGATGCGAACTGGGGTACTAACCTCGACGGCATGCG
TTCTGTCTCGGGTGTTATGGGAAAGATTGGAAGCGCTTCTGTGGTGCTAAAGTCAAAGTTCCAACGAACGGTCCCCCTCAGCTCAGCGCAAGCTGAGTAT
ATGGCTTTAATAATATGAGTTCAGGAAGTGCTGTGGACGCGTGAGATGCTGACGGACATGGGAATGATACCAAATAACGCTACCCAGATCTGGGAGGACA
CTCAAGGCGCGATTGCCCTGGTACAAAATGCTGGTTATCATGCTCGGACCAAGCATGTGAACATCCGTCATTACTTTATCAGAGAGACGATTGAAGAAGG
AACGCTTGTGATAACGTATGTGGACACAAAACATTATTAGAACGACATAATAACCAAGGCGCTAGGATCCAAGACGTTCAGTTCCTGCGCGATACGAACG
GAATCTAGTGCAAGGACATCAAGCAGTAGTCGTGAGTGAGAGTGTTGAATAACACGGATCTGCACAGCTTAAGAGTGATGATGAACTGCATGGACGGCTC
AACTGAACCGCATGAACGTTCGTCTGATTGGCTGAAAAGCCATGGGTGGTGATCAGACAATTCAAGAAGTACAAGGAAGGCAAGGGGGACAACAGAGAGT
GGTTAAGGTAACTACTCACTTCATGAATCTTTGATGTGGGCAAATCGCACCATGGATTCCTTATATGATAAAGCACACCGCCAGCCTTTGTAATGAAATT
GTAGTGATTCGTAAACTACTCTTTGTCTAAATATGAAGATCTATTTACAAGTATATATTCTGAAGCACATGATAATGTCGAAGTGACCAAGGTTGTCAGT
TTGCGTTGTCTTCTTTGTAGATGGCACCTACTTCACCTAGATTGTAATAATGGTCTCATGTGCTCCACACATTATGACCTAAATCACGAAACCAGAAAAG
CAAGGTTTTGTCGATAAAAGTATGTGATCCTGGCTCGATGCCAAATGTAATCCTATATGTTTCTGTCATTCTCCACCAGCAGACCTCGATATAGCAAAAA
GAATACAGCAAATAGAAGAAGGTGCATGTATAGTAAAGCAGATCGAAGCAAACGGGGGCGATCAATGGGTGGAGCGATCTCAAACCGCGACAGTTCAGTG
AGAAGTATCGATTGGCTGTTAAGCTGCGCAATACCAAGACCGAATATCGCAATATCAAGATCGAATACTACGATACCGAGAGTGAATATCGCAATACCGC
GATCAAATATCACAGCAACGGGCTCGAATATCAAGTTGCCAAGATCGAGGCAAGATACCAAGATCGGGAACACATAAGGTGTTCAAAGTCGGGAAGATGA
CCGACAATCGGCAAGGATCACGGTCCTTGAGAGTGATCGACGATCAAGTGGATCGACGATCAGGAGATTGACGATTGATCAGAAGATAATCGAACAAAGA
GATCGACGATCACTCAAGGAGATCGTCGATCGGTCAAGAAGATCGACGATCTATCATCGGAAGTGGACCACATTTGCGAAGGAACGGTCAACGGAAGGTA
GAGGACACGTGGCAGCATATCCTGGCATATAGACAGGCATATTCGTAGTTTTAGCTTTTGGTTGGTTAACATTAAACAGAATTCTATTTGCTTCTAAGTA
CACGTGTCGGCTTCTCTTCCGGGCTGGAACATTGGCCTCCCGACGTCAAGAAAGACGCGCATACTGAAACCAAGTGATATCCCCAGATAATTGGCTGGGG
ATCAAGAATTCTCAAGACAACCCCAACTGCGACTGGACGCAGCAAGAACGTAAAGGACAAGGCGCAAGATCGCGAGACGGCTCAAGTGGTCAGAAGGCTC
GCGTATCAAGCATCCACCTAGTGGACAAGGCGATCTCGTTGAGATCTAGGTGGCTTACATCAAGTAATCTACAAGTATACCCGTGATCATGTGAAGGTTT
CCGCGCGATCACAAACCCCATTCCCAACACGACCAAGTTTTCTCTCGACACGAGTCCACCGAGAAGATTGCAGCCCGCCCTACCGACGGGTACACAAAGT
GAGGAAGGAAATACAAGGCACGGAAACATAGTACCCCCTCCGATAGTCGGTCTTCTGGGCACCAGTGGAGAGTCGGGATTGCCTCATAAAATGAGCGATC
GCCGCTCTACCACACATGCAACATAATTCTGTTCATATGGTTTGCGACAGCCGTCACGACCTCACGTAAGTTTGTAGTGTATCATGAATAAGAAATTGAT
CGTCGGTTGCATT