Description :
From Genome Similarity Track
Location :
Scaffold_17:688558- 691246
Sequence
2688 bases(100 bases per row)
TTGATTCGTTAACGTATCAAAGTGCTTGTCGATGGCCTCAGCGTCATCATTGATGGCGCTGTATCGAACAGCTCTACCGGGACTGGCGGCGAAGTCTCGC
CGAATCTGGCAGTGATTTCAGATGCATTGGCAGCGTACGCCCGGTACAGTACGCGGAGAAGAAGACGTACCAACACAGGTGGCTGCGTCTTTTCTTCATT
GCGCGGACGCTTCGATCCTGGGGCGTCCGAAATATCGTCACAGACTCGCCGCGACTCAACAAGGGGATCAGGGGTTGATTCGGTCGACCTAGAATCGACA
GCTGAAGATGAGTTGTTCTCGTCTTCAGTGTCAGACCCATAGTCAATGGGTATGTCTCCGTCAGTAGACATAACTGACAAGCCCTCCGTGACAACTGACG
GTCTGTAAGTCGTAGCTTGCGCGCACTCTGCTTATGCAGAGCGTGGTTTTGAGTGACAGAAAAAAAATGTCGTGGGCGTGTCCGTTTGCGCGGACACTGA
AGTGGTGGTGCCTGATTCTTATGCTTAACGTGGGGGGGGGTAACAAAGTTACACACAAGCGGCTACATGAAGCCACTTGGTTACGAAGGAGGTTTTCCAC
ATTGGTGTGAGATACACCGATAGTTACATTCGGTAGACTATTGGTATGCATGCATTTGGGGTACTCATTGGTTGAAAGCCAATACCTTTAGCAAATTAGA
ATCGTAGGATTCTGCCAACCATTCGTTGGCAAATACCTTTCATTTAGAAAAGTAGATTCTGATGAAAGCTAAAGAAAAACAAATAAACAGCTTTCAATTT
TACCGGGAATCGGCTTTGCTTCCAATATAAGTAAATTTATACTTTTGGTCGAAATTATATTAAATCTGCATCTTATGCTTTCGCATACGTGTGCGTTAGC
GTGCAAGCCAAAGTATTGGGCATAGAGTAGGCCCATTACAGCTCGTCATCGATGACACCTTTAAACGCTTTGTCGCCTATGTCAATCTACAGATTGTGAA
GCGCTGTGGCGACACAGATTATCTGCGCATTTGTGATGTGGTCTTCCGATCTGTCACACCATGCAACACGTTCAACCTTGGCTTGACCTTGTCAAAGGCT
CTCCACAGTGATTCGCGTTTGAAAGAGATGATAGCTGTAGCTACAAACCGTTAAATATAAACACACAACATTAGCACCAAGCAGTAAGTGTTATTTTATC
TGGAGAATACTCTAAGTGTCTCAGACGATTTATGCTCTGACAAAGAAACAATTAATTAAAGTTTAATGTATAAAGACATTTACAAACCGCAATAAAAACA
AGTTGCTGTCGTTGTCTTCTACTTCTCAGCACCATTTTGCATCTTTAGTATTGTGTATCCTACTCTAAATTGCATTGCACGATTGGTCCAATACCAAATC
TCCATCAATCGCGCAAAACACCTGTTTGACTATGAAATCTTTCTAAATACGATTCTAGGCTGAACCACATGTCAAGCAATCCATGTTTACCAAAAGGCGC
GATTGGCTTGTGACTTGAAATTTGAATGTGGAGGCTTTGAAAGGTTTGCTGTACCTAAAAAATAACTACAGTATCAGAATTAATTAGTGAAAGTGTGTAG
TATCCACGCATCTCTCCTGGCAGTAGATCAAGCGCCATTACAGTATCAACTCTCGCGAGCTCATTAAGCTTGCGAAGACCTGCTGCAACACCGGTACGTG
TTCCATAAAGATCATACACTGCGTGCCAGGTTATTGTGGCCACTTACATTTTAGTATGTGACTCAGTCAGTTTTACGAATTAGCTCCAGTAATGTAGGTC
GTCGTGATGATGCGTACCGCATGCGTGCAGCGTTAGAATGTGTCACGTCCATCCGGTCGGCGTTTCCTGAGTCGGTGTCCCGTGGGGTCAGCGTCTGGAT
AGACGTAGCTGGCTCTACTCGATCTGTTTCCTAAAGTGATGAACGCTGGGCCTGACCCTCTCCTCCAGCTGCGACAAAGTATACCCGGGTAGATCACATC
CAATTCTGATCCACTGAGACCCGAATCACTGTCGCAGCTCGTAGCCTTCATGGCTTGCACCTTGCGTACTGGGTTTGACCTTACGGCGTCAGAAGTGGTT
AGCTTGTGTCGGTACTTGTTCAATCCAAAATGGGCCTTTACAGGGCCAGACGGTTCTTTGCGCGTTGCCGCACCCTCAAGACATCTTCAAGCAAATCTGT
ATCTGCGATCCGTAGCAGCGCAAGCTGATCAGCCAGCCAAAACGAGGTCGTCCAATGTTTTGATGAAGTGTTCTACGTGCCCACGGCGGACATCCGGCGG
ACTATGCTTAATACGCAACTCCTCCCTCAATCCTGCAATACTCAGGCGATAGCGGTATTCTAACGGTGTTTATCGGCACATTTCCTCGCATGGTAGTACT
GCCTCGCGACGGATACTCCGAGCCCACAGAACCGCACTTGAAACTCGGGCAGGAGTTCGTTCCAATCGATTCGAGTAGTCCGCCTGAGTTGCCGGTAGCG
CCGATCCGGTGAAGAGACTGCCAAGCACCAAGCACTTCTCATCGTCCGGGGCCTGGCTGCGAAGGAAGGCTGCCTTTACCTTGCTGACCCACGCGAGCGC
GCGGTCTTCGTCGTTATCCTTCCGGAGAGCACCTTGAATTCCGACATTGCGGAGACGCGAATGCGTGGCGTTATCCCTGGCATTCCAA