Description :
From Genome Similarity Track
Location :
scaffold_717:6885- 9405
Transcript NameFunction/comments
g9972.t1 conserved hypothetical protein

Sequence
2520 bases(100 bases per row)
TTAAAAGCCGAGCGTCGCGCGCTGGTTCCGATACACGAGTTCTGGGTCTGCTGACTCTGGGGACGTTGCGTTGGCAGCGTGAACAGGAGTGCTGCCCCTG
GAAGAGGAAGCGACTCCGCCGTCGGTTGATCCTCGACCTCCTTGCTGCATGAAAAATGCGTGCGCGAGCTCCAACGCCTTCACCCACTTGAGCATTTCCT
CGTGGGTCTTCGCAACGAGACGCGTCTGGTGAGTAGGCGAGCAGATCATAAACTCGTTCGGTTTGCCCACTTCCTTGCCATGAAGGATCTCCAGCGACTT
GTGCTTCAATGGGATCGCTCCACGCGGATCGCGGTCGCCCTCACGCTTGTAGTACCGGAGATATCCGTCTGGCTCGATGTTGCACCACCGCTCACGAACG
CCACGCAGCGACATATTGCCGAAGGTACCCTTTTCGTTGGAGTGCGTCGGGTGCTTTCGCAAGGTGCCACTCATTGTTGGTAATGAACCATCTCGGGGGA
CTGGGTTCGAGTTGGAGTCGTACGACTGTGTCAGTGAAGCCATAGACGCACTGCTGCTGCTTCGGTGGCTGAGGTTGGGATCGTATCGTTCAGAGCCTCT
TTGAGCGCTCGCTGAAGGTCTGCCGCTGTGTGAAGCCCTACCACCGATGGATGTCCTGTTCCCATTCATTGAGCCACGGATACCACCACCAAGCGATGCT
CGAGAGCCTCCCGTAGACCTCCGGACATCCTGAATCGTCGGTGGGCCGACAACGGATGGCCTCAAGTACGGCTCTTTGCTCTTAACCGCCACATTGAGTG
TTCCGTTTGTCAGCGCTTGGAACTGGTCCTGCACCACCTTCATTTCGTCTTTCAACTGCAATCGTCGTTTGCTCAGTTCGCTTTTGCGAGCCTCATCCTT
CTCCCCTGCCGCCTTCGCAAGAAGAACCACGGTATCGTGCAACTGCGCCTGGAGTTTTGTCAGCTTGTTCTGAAGCCGAGACGATTCCGACACTCGTTCT
TGCGGGGCTTCATCAATATCAACATGGTTGACAGACGAGTCTGCGTGCTGAAGCTTGACTTGCTTACCCTGGTCGACGTCAAAGAACACATTCAACTCGT
TCTCCATCCGTCGCATTTCGTCAAGGGCTGCCTTCAAATCATCCTTCAGATCCGCACGCCGGAGGGACAGATTATCAGCCTGTTGTTGATCACCGCCACT
AGACGCCTTTGCGATTCCAGCCACAGTCTCACGCAGGTTTTTCCGCAGCAAGGCGATCTTATTCTCCAAAAAGATCATCTGAGGCGGACGCTCGCCACTA
ATAAAGGCATCCTCGCGCTTAACTGCCTCTGTTGCCACATCCATTTGCTTCTGAAATTGGTGAATTTCTGATTCCACGAACTTCGTTCGCTCCTCCTCCA
ACTTGATCTCTTCTTCAAGATGTTGATGCTGTATCTTAATTTTCTCGAGAAGCCGCTCGCGTGCATCCTCAGCGCGAGTGTCGATAGAGCCTCTGTGCAC
CATTGAGCCCAAAAACGCCGGCGAAAAGAACTTGATCTCCTGCTGCCCAGTTGGATCCAAGTCGAGATCTCCGTAAACGTCCAGCTCCTGTTGCAGATCA
TCCAAAGTCTCCTCAATCTTGACACGCGATGCCTGGAGTTCGTCATTTTCGGAGATAATTTCAGTAACCTCTTTTTCGAGCTCCGCTGTTCGCTGGGCCA
GCTCCGCCGTCCGAAGCACCTCAGGTGATTCAATTTCCCCAGCTATCTGCTTGTCCAACTGCTCGATCATTTCCTTAAGCGAAACAGCCTCTTGGATGAA
ATTTTCACGCTCCTTCTCCATAGATTCTTGGCGTTGCTGCTCCGCTTCGACTTGCGACTCCATGACCTCAAACTTCTTTCCCATCTCAAGCACCTTGAGG
CGCATGTGCTGCTTCGTCGCTGCCCACACTTGCTTGTGGAGTTCGTGCGACACCATAATCTCAAAGTATTCTGCACGTAACGAGTTCTGCATCACTCGAG
CAGCACGAGCCTCCTTTACTTCTTCGGTCTCTTCGTGTGGAATCTCTTCCTCAACTCGACCCACAATGCCTTTGGAGATATCAGCAAACTTGATGCGGAC
AGGGCGAATCATTCTAGCGAGTAGTTCCAGCACCTCTGAGTACGTGTAGCCAGTCAGAGAAACCCCATTCATCATCGTCACACGCATGTTCACTGCAAGG
CGCTTCTCAGGCTTCACGCTCCAGTTATAAATCTCTGCAGGGCTTGCCATGCCATTTGGCAGCTTGTAAATCTCCGCGATGTGGACCTGAAGATCAGTAA
ATTCCGTACCAGGAATTCCCGCAATTTGCTTCAGGTTGAGTCCCAGCCGACCTGGTCCGAACGTCACCTCGATTTCGTGAACCCAGTTGTAGATGACTCC
AGTTTTCATAGGTGGTCGCAGCCACTGTGTATGTCCATAAGGTGACACATAGTACGTCTTGCCGTCGTTTGTTTTACTCTGGCGCGTGGACCAGCCTTTC
GGCAGGGCAAGAATCTCCCC