Description :
From Genome Similarity Track
Location :
Scaffold_5:68837- 72029
Transcript NameFunction/comments
Albla_Nc14007810tRNA wybutosinesynthesizing protein putative

Sequence
3192 bases(100 bases per row)
ACGGCTACGCAATGGATATCTGCTACGTAATGGTAAATTCTTGGCGCGTATGACTTCACCTTCTCTACATGATGGCATGTGACGATCCAATTTCTATCAA
TTTCTTTGGCTAGTGTTTCTATCGAGCATTCCACATGCTCAATCCAAGCCTTTAATTCCTGCTTCGGGACATTTTCGTGCACATGGAGCCAGCCTCCAGA
TGATTTAAGCACTTGGACAGCCAGAGGCCAAGCTTTGTCGCTTTTTGGAAGTAGTCCAAGATTGACACGGTCCGAAATCGGACCAATTTTACGTGCAGAA
ACTTGATTGTCTCCTTCATGTATCGTGCAGCGCTCTGAAACGCGATTTCTTAAAAGATTGTATTGTAAAGCGGTGATCGCATCAGGATTCCAGTCGCAAG
CATGGACCATCGAGGCACCACCATGAACCAAAAACGGAAGGACATAATAACCGATTCCGCAAAATAGATCGACAATTATCTCACCTTTGCAGCTGATGCC
AGCCATTCGAGCTTTTTCGGTAATGTTGCCGGAGGAGAACATCGTTTTAGTGATGTCAAGTCCATACACAATACCATTTTCTCGTACTTCCACCCAGCCT
GGCGACTCCGTTGTATTTGGAATATTACACACTTCTTGATGCACCGCTTGTTGCTTCCATCGATCTTGGTTGACATATATTAAAGAAACGCGGCTTCGAC
GCATCTCGCCATTATCAATTCTAGCTTCACGAGCAACTCTAGTCAAGCATGGTACAACTTGCTCGCAGATACAAGCCCACATTTCCTGTTCGAAACTCCC
CCAGCTTTCTTTTTCAGCACAGCATGTCGAGTTTAGCAAAATTATATCCCCAATGTATTCGAATCCTCCAGATATAGACTTGAAAATTTCGCTTTCCGAT
ACGTCACGAGAATGTGCAAATCTTGTGATGATTGTCCGAATTCTCTCATCTCTGGTCATGCCGCTTGATTTTCCGCACTTATTCTTCAGAGCATTTGAAT
CTTCAACAATGTCGGTTGATGATACACAATCTGCAAGTTCATCGTATGTCGAGAGGGCAGTGTGGATATCACTTGTCACCGGAAGTAAGTAAACACCAGC
CGAGACTTCTTCGCCAGCGACCTCGTGCACTCGTCGAGTCTTATCATACACGCTGACTTTTTCCAGCAGTGTCTTCATCCATTTTACTCGCTGTCTCGCG
GTTAGAACACCCAGTGATCCTGTAGAGAGTTCTTGTTTGTGTTGTGTATAGTTGACGGCGACATTTTTAGTTGATAAAATCATGGGCGCGTCAAGTACGC
AACAGACGCTTGACGCGTAATGGTAGGCGAAGCCATAACATTGAAATCCTCCTCCCGTGATGTATATTGCATTATAGGGTTGTGGAGCCCAGGTAGATGC
TGAATGTACCAATGAGGAACTGTCGTGTTCGCAAATGATTCGTGCTGATTGCCATTGGAGATCGGTAGTGTTCAATGCATAAAATGGCTCTTCAGCACGT
GATACTCTAGAAATAGAGGCAGAGGTCCCGCCAACAATCAAGACAACATCACACTCATTGCCCAGAGCCGAAATTGTTGCCCCAAATCGGGTTGTTCGCG
GTCCGAGTTTCGTGTTACCAATACTTTTTTCCTCCCAAGTCTCCGTTTCAAGGTCGAACAGATAGCAAGCATTTGCATTCCCACGTGCTACTTCTATTCC
TGAAAGCGTTGCTAGTCCACCCCAGAATAGTAGCTTGTTTTGCCTCGATACATACATGCCAACATGATCAAAAGCTGCATACACGAGTTCGGATGATAGA
AGACGCCAAGCAAGCTTGCCCTTTGGAGCTGCGACGTCTAGGACCCACAAATCATGAAAAACGGTGCTGCTATCTCTACCTCCATGAATATACAATTTAG
AGCCAGCAATGCATGCGACGTGATTCCACCTTGCTGCAGGTATCACTGGTGTTAGAACACCCCCGGAATCGGGTAGTATCTGGGTCCATGTGAAGGTACT
CAGGCAGAGTGCTAGAGTATCGCCATATGCTTTGCTTGGACTAGCACGACCACCAAATACAATCATTTGTTCTGATTTTACATCTATCGACGAGGAGTGA
TACATACGAGCCCTCACGATGTCATCGTTCGCAATTTTTTGTTCATCGATGATTGGTTGATCCTTCTCATTTTCCGACAATTTTAGAAGCTGTACACTCG
ACAAACGCCTCACGTTATCGTTCTCTGTATATCCTTCACCACCGAACACTATAAGGTGACCTTTATGATAAACAATTGTATGGCCAACCCGTCTCAAAGA
TAAGGAGACATCGACCATAGGGCGCACGTAAAGGATATTTGAAGGTGCTTTCACGGGAATCGGCACACCCTGCCCAAATTGCTGTCTGAACGCGATTCTC
AGCTGATTGACTCTTTCTTCATTTCGTCGAAACCTTTCGTTGGCAATTTCAACAATCCAGGAAAGATAGTTTTCGTCAACGAGAATTCTGCTGCATTTTG
CGAGAGGTACTTCTAATGTGTTAGATGTACTCCGTACAGCACACATAATCTTGTCTCTGTTGCCTACGTCAATGAGCACATCAGTAAAGTTTCACTGACA
TGTACTGTTCGCTAACAACATACTTATTGTTATCCCGGATTCTGTGAAACCAAAAGTACTACCCCATTGAGCTAGCTTTCTCGCCGCATCAATGCTTCGG
CAAATTGCGTGTAAAATGAATGGTTCATGTTTGAATAGAATCTACTCAGCCCAATCAATATCCCTCATTTCTGGAAGTCTACCCACACAATTCTCCTCAC
CATTCCAGAATCTGAATTTTCGATCCCAGCGCTCAGCGTTGCTTTTAGTTGATCCGATGTGATGAAATTGTGTTCGACGAGAAGCCATCGCCCACCTTTG
GAAATGAGATTGCTTGACGATGAATTTCCATTATCGGGTCTAGATGTGCTCACGAAAACAGCAATTCGTCCCGAGCAAGAGCTACTTGTAACCTGAGCAT
AATGTCTTCAATTGGCGTAGTCCATTCATGGTCGACATAGTAGAACGTACATAGTCAGGATTCTGGTTGATTGCATTTATTAAGTCCACAATGGGTGCAT
CAATGCTGCCTTTTGGGCTTTTATCCCGCGATGAGTCAAGCTTTTGCAGAATCTCACGCTTCCACTGATCGAATAGCATCTGGTCGAGCCAG