Description :
From Genome Similarity Track
Location :
Scaffold_1693:688- 3981
Sequence
3293 bases(100 bases per row)
CTTCCTCTTAATCCGCCCCTCTCTTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCGCCTCCTCCCGACCCACACCCTT
CCTGTGGGTCCTTCCATCGACATGACCAACTCACATCCATGGATCCCTTTCCTACTCTTCTTCATGAAACTGCATCACGCCGAATCTGTTACGATTCGTA
CGATTCCGCAAGAAATCATAGGGTAATGCTCCACCGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACTAGAAATTCAC
GGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATGTCGGTGATCTTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAGCTATCTT
CCGGTAGGAGGACTTCGTCGAAATCCACTTGGTCGGATTCATCCACCGAAAGACGGGTTAGCGGCCGGTCCGGATATTGCCTGACCCGCTTCAGCTTGGA
TACGTGTACTACAGGGAATAGGCGATATTCGGTTACTGCCGTTTCCAGCTTTACCGCATGTTCTCCAATTTCTCGCTTACCCGGAACGGTCCGTGCCATA
GATGGGCCAATTTGCGGGCGTACCCTTCTTTCCCTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGTCTCCGTTGTG
TCGATCCGCTCGATCCTGTATCGCACTTCGTAGCCGTTCGTTCACTTGGAATCTGGCTTGCCGATAGTTTTTCTGGACTTGGTATCGCCATCGTCTTGGA
TCTCGGTTTCTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCCACCCATGTACCAAGTAAAATGGGGTATCGCCTCGG
ATCCCTGTCCTGGGCGGTGTTCATCGCGAAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCCGTCTGATCCAAATCCTGGACATACATCTTGAGTGCCC
TCGTGATCGTCCGCACCATGCGCTCGGCCGATCCGTTAGCTTGGGGACGATATGCCATGGTTGCCCGCTGTCTCTGCCCCAGGATCCGGTTGAAAGCTCG
AAAGAAATCAGACAGAAAGCCTGGCTCCCGATCATGTCTAATCATCTCACTAGCCCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCGGCAATGGTT
TGCGCAGTTCTAGACGCACTAGCCTTGGCTATCACGTATTCGGTAAACAGATCCACCCAAATCAACAATTCCGTGTTTCCTCTGAACGACTTGGGCAACG
AGGGGATGTGATCCATGACTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCCGGTGACTCCCCTTCGAGTGTGGGCCTGACCTTGCCTGTCTCACA
ATCCACAAATTCACCGACATATCGCTGTACGCTCTTGAATAATCCCCTCCAGTGGAAACTTTCCCAAATCCGTTTGTAGGTCCGACCAATACCCTGATGT
CCACCTTCTAAACTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCT
TCGTAGGGGAAGAGGGGGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGTGTAATCCGTAGCGATAATACTGTAGGATTTGGTATCCTCTCGACT
CAGGTCTCGTACATCCCCCATCAGAAATTTCTTTAGTCCCAATATCCACGCTTCCTCGTTATGTGCTTTGAGGATCCGCTCAATGCGGACTCCCTTCACA
AATGTTTCATCGAGGATCTGGGGGCTGGATCCAATCCTTCCTCTAAACTTAGTGACAGCCATTACCTGGACTGTCCTTTTTTCGGATCCAACCACCACCA
CTTCGTCTAGTCGGTTCAGCGTGACGAGATCCTGATGCTCAGCCTCTCTCTCCACCTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATC
CGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGG
GCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGATCTTGTCCCTTTAGTAAATCCAAAC
CCAGAAGGAGTCCGTTATACTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAATCTCCACAGTAT
TGCACTGTATGCTCCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGAAGTACAGATCCTCATCCACTTGTACCGTCGGGATCGGAATCTGG
ATCTGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCTTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGT
CTTCCCCTTTCGAACATTCCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCA
AGCTAGCGTAGAGTGTCGCGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGAGATCCAACACGCGCAGGAGCGCGAGTATCTCCTTCTCC
ACCGCTCCGTAGTTCGGTTCATTTGGCTTCAGTGTCCGGTTAACGAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTACCAGAGCTGCTGAGACTG
CCCAGTCACTGGCATAAACTATTACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGTGTGGTTGCGATCCTGTTCCTCAGCTCTACGAATGC
GTATTGAGCTCGGATCCACCGAGGTTCCGCCTTTTTTAAACTCTGGTCCGTCGTCTCTATCCTGATTGGATCCTCTTTCCGTTGGTCCCAGGGGGGGGGA
TCCAGCTCCTATTTTAGGTCTTCTTCTGGCATCTTACTACCTGGACCCCCTCGTGGATCCGACATCTTCAGGGCCAGAGCTTGTTGAATTTTGATCCGGA
CAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATACATATAATACCGCAGCAAACAGTGCGTAATCCTCGATGAACCGACTATAGTAGTTCAA
ACTGCCCTAGAAGGATTGCATCGCCCGTAACGACTGTGGGAAGGACAAGTCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTC