Description :
From Genome Similarity Track
Location :
contig_172:688- 2236
Transcript NameFunction/comments
g11892.t1reverse transcriptase

Sequence
1548 bases(100 bases per row)
AAGCCCTGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCG
CGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACATTTGAAGGCGTAGGCCATTCATTGATCACTCTGAC
CTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGC
TTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGT
CGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGCGTTCTTCAGCCCCTGCGGCATCACGAGC
CACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTAC
TGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATG
AACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCA
AAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCT
TGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGC
TCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGT
CCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTCGCGAGCGAAACGCTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCG
GAGGATTTCCAGCCTCATCTTCTTGTATTGGGGACCAATATGTGGTGGAGAGGGATCACGAAATTGCTGACGCGATCGCAACTCACCAACGGTTGCCCGG
ACTGCCGACTGTCGGAGGGGGTACTCCGTTGACCCGGCGGATCTTGACCTTACAGCTCACCTTGTGTACCCGACGGCTTGGGCGGGTTACGCTCTTCCGG
TAATCACGCGAGGGAAGTCAGTGGTGAACAGGGCAGAACTGGGGCTTGAGGGCCCTTCAGGGATGGGGGTGGTTGGCTGCCACGCGGATATGCTTCACGC
AGCAGTCGGTTCGGGTGACGATCGTGTGTGATCGATCACGGGGTGTGT