Description :
From Genome Similarity Track
Location :
Scaffold_2139:688- 1701
Transcript NameFunction/comments
Phymu_g13910hypothetical protein PHYSODRAFT_507730

Sequence
1013 bases(100 bases per row)
TCCGCATGGTTTCCACGACTGTAAAGGACCCCAAAAGCGTGTCCTCTTGAGCGACGTAGCTGGTCACGGCCCGGAACGTCTTGGACACGCGCTCCGTGCC
GTTCACTTCGATCAAACCGGACACGTCGCCGGAGCTGATGCGGTCGGCCAATAGATCCACGAGCGTCGTTTTACCCGAACCGGACGGGCCCATAATGGCC
GTGAGCTCCCCGGGCGCGCACCGGCCGCTGACCCGGTCGAGGATGGTTTTCGTGCCCCATGGTAGCTccggcgtcttcttgcccttgacgGTGTAGCTAA
GGTCGCTCCAACTGAGCACGCACGGGTTGCGGATCCGTTCGTACTTGATGTGGATCTCCTGGTCCACGACGGTGCGAGGCTTGTCGGACGGAGTGGGTTC
TTGTGTCGGGTCGCTCTCGAGGATCGCGTAGCCTCTAGGAGACAGAGACGCCATGGTCGCAACGAGGTGAATTGCCGAATGAACTGGGATCGGATGGGAG
GGAGCGATGGATAAGGTTCATCGTCTCACCTGGTACTTCTACAGTtggtactacatgtacaggcCCGCGGCCGAGCAGATTGAAGCAAAGGCGCAGTGAC
GAGGCTCTTGGGTCACGTCGCGACTCGAGTCCGGCACGCAACAAGAGCCTGACACCGGTGGGAGCGGCCTATCGCGAGGATGTGACCGCCGTTCCGCCGC
TGACAGTATGAGCAGGACAACGGTCAGGCACAGAGGGACCTTTACATCCATGGTCGTCGGTCGCACCTGTTTATGCATACATGTTCTGTCATTTTAGTTA
CAATGTTGAAAAAAACTTACATAGGATAGTTGAATTATATGATACGTTACTTGCTAAACAAAACCTAGCGTCGACCAGTGTGGAACTTCCAAAGGATAAA
CACGAAAATGATCTGGAAACCGGCGATGTACGCCACAAGGTACAGCATGTCCTGTGGGacgtccacgttctccatccCGTACTTGGTCAGAATCGCTTGA
GCCTGCTCCGACG