Description :
From Genome Similarity Track
Location :
contig_5:68771- 71698
Transcript NameFunction/comments
g1498.t1OWZ19496.1 hypothetical protein PHMEG_0006254 [Phytophthora megakarya

Sequence
2927 bases(100 bases per row)
ATGCCCGCCTCCAAAAAGCGCATTCAGAACCGCGGCACACTCAATGTGGGCACGCAGCAGGTGCCGGCGGCGCTACAGGACTGGGTGCACATTTGGCACG
GCGTCAAGGTGAACAACGGGTCACACGACACATCCATCTTCCACGTGGGCTCCCGCGTCGAGGAGATGCCGTTCTGGAAACAATTCATCCGCCTGCCATC
CAACTCGCTCTTCTCCAGGGTCTTCACGAGCGCTAACCCCAGAAAACCGTACAAGGACTTCCTCTACGTGCTGTTGAACATGCGCTGGCCAATGCTGTTC
ACGGTACTGCTGACGATTTTTCTGGTCAACATTTTCTTCTTTGCGGCTGTCACGTGCTTTATCTGTGAAGAACCGACCAACTTCTTTGAGGCGTTTGACT
TGAGCTACCAGACGTTTACGACAATTGGCTTCGGTGTTGTGTACCCCACGCGAACGTGTGGGAACGTGAGCATGTCGGTGGAGTCGTTTGCGTCCATGAT
GATCGTGTCGGCCAGCACGGGTCTTGTGTTTGCCAAGTTTGCCAAGCCACAGGCCAAAGTGGCGTTTAGTAAAGTTTGTGTTGTGCAGCCGTACGGCAAA
AAGTATCTTGCGCTTGTGGTGCGGGTTGCAAATGCCACGCAGTCACGTGATGTGACGCACGACGTCATCATGGAGGCTGTATTCAAGGTGAATTTGCTGC
GTGTTGAGCACAAGACTAAGCACATTCGAGCTCACGATGACGAAGTCTCGGAGAAGCGAAGGCTTTCTCGTGCAGCTAATTACGTGATAAACGAAGCTGA
AGATGCAGTGGATAACCCCGCTTGCTCGCCTACAAAAGTGCTTACATCGTACAACCTCAAGCTACTGCAGAACAATTTCATCACCTTCCGTATGGGCGTA
GCCGTCGTGCACGTGATTGACGAAAACAGCCCGTTGTATGGAATGTCAAAGAACGACATTGCTCAGTCGGATATGCTCGTAGAGGTTGCTATGTCAGGTG
TCGATTCCACGCTGCAAGACACAGTGTCCGAGCGATACATCTATACGGCAGTAAATTTGATGTGGGGGTATCGTTTTGCTGAATTGCTGGAGTTCAACGA
GCGGAATGCAGAGGTCATTATGAACTTCGCAAAACTCAGCACGGTGGAATCCGCTCCAATCGACGATGCCCGCTATCTCAAGCCAGTTGTCTCGAGTGGA
AAACCTCGTGGGAGTAATGAGAGTGCAAATAGCGGGCACTCGCACAATGTAGCTGACCGCCGTTCGCATCATAAGTCAAGGGTGTCTAGCCACCAGGAAG
AAAACCACCCGTATCATGACGAGGCAATTCATGAAGTTCCGGCAGAGTATTCGGAGCCTTTCATGGTAAGCTCAAGATCAGGATCTTGGGACGCCCAGTC
ATCAACAGACCACGCGATGCCCGCACAACCACACCCTCCAGTACAGTTCCCGAAGAAAAATGGACCAAAAAGTTTGCAATGGGTCTAGAGCCTCTGTTCG
AACCATTGCTGCAGCAACCGTTTGGAACACAGCGGATACCAAAAGCCCCTTCCGCTGAAGCTCGAGCCGCTCAAAGGGGAGGACTGCGTGTCTTGAGGGC
AAACGAGCAGGTAGGCCTGGAGGATGGTCGGGGCGGACAGGCTTTGACTGCAAATGAAGACATTAATGCTCGAGGCCGCGATAGTAGCGGGGGTGGGCGT
AGCAGCGGTGGTGGTCGGGGCTCATTCGAAGGACCGAACCATGTTCGAGCGAAGGACCTGCTTCAAAGAGAAATGGCAGGGTCAGCTTTGATCGAGGACG
ACACGAGTACAATTTCTCAGGAGGAAGGGCACAAGGATGATAGTGACGATGCTGACAACGTCGACACTGATGCCAGTGACGGAGAAGACTGTGTGGAGGA
CGACTATGACCAAGATGACTATGACCAAGATGATACTCCTCGGCAACGGTTGCGGGTTCAAACGACTATGTCTGCAGTGTCGATTGAGGTTGAGGACACG
CCTCGCTTCTTGCGCATTCTTCCTGTCCACATCCCGAAGTCTTTCAGTTTCATGCGGTTCTACCAGAGTGCTCTCCATGTGGGCTGGCCAAAAATCATTG
TTGTGTTCGTACTATCGTTTCTAGTACTGAACTTCGGCTTTGGTCTGCTGTACTGGTTTGACGTGAGCCACATCTCAGCGTACACCGATGTGGTAGTCTC
CGACTACGAGTTGGCCTTCTACATGAGTGTTCATACGCTTGCTACGATCGGTTACGGCTCGATGGCCCCGATGCCTGATGCCGTTTACATGAATGTAATC
GTGTTCATTGAGTCGATGGTGGGTATTATCGCCGTGACAATCATCACAGGCATCGCCTGGTCCAAGTTTGCGCGACCCCGAGCACATATCCACTTTTCGT
CCAAGATGACCATCTCGACCATCTATGGTCACCGTTGCCTCGTTTTCAGAGCTGCTAATACAAGGCACTCCGGCGAGGTGCACGAGAACTTTTTCCGCAT
CGGCGTGATCCTCACAAACCGACGCACAGGGCTGCGCCAGATGTACGACGTGCCCCTGGTTACTGCTGAGTGGCCGTCTATCAAGCTGCCAGCGACACTT
ATCCACGTCATCAACGAAAACTCGCCGTTCTACAAGTTTCACTCGATGGAGGACTTATCGCAGTCGCGCGTCGCAGTCATCGCTTTGCTCACAGGCCTCG
ATACGACTTTCTCGGAGAATGTGTACGCGCGCAAGATGTACTTCTGGGACGATTTTGCGTACGACATGCGCTTTGCTGACTTCGCCGTTATTGAGCGTGA
CCGCGTGATCGTGGACTACGACCGCTTTGATCGACTCCTTCCAGAAGACCGAGAAGAGCAAGTTATGACCACTCCTGTGCTCTCTGTGAGGTTTTCTATC
GCTGACTCAGTTTAATGTAGATGGTAT