Description :
From Genome Similarity Track
Location :
scaffold_5:68768- 71696
Transcript NameFunction/comments
g8105.t1hypothetical protein

Sequence
2928 bases(100 bases per row)
ATGCCCGCCTCCAAAAAGCGCATTCAGAACCGCGGCACACTCAATGTGGGCACGCAGCAGGTGCCGGCGGCGCTACAGGACTGGGTGCACATTTGGCACG
GCGTCAAGGTGAACAACGGGTCACACGACACATCCATCTTCCACGTGGGCTCCCGCGTCGAGGAGATGCCGTTCTGGAAACAATTCATCCGCCTGCCATC
CAACTCGCTCTTCTCCAGGGTCTTCACGAGCGCTAACCCCAGAAAACCGTACAAGGACTTCCTCTACGTGCTGTTGAACATGCGCTGGCCAATGCTGTTC
ACGGTACTGCTGACGATTTTTCTGGTCAACATTTTCTTCTTTGCGGCTGTCACGTGCTTTATCTGTGAAGAACCGACCAACTTCTTTGAGGCGTTTGACT
TGAGCTACCAGACGTTTACGACAATTGGCTTCGGTGTTGTGTACCCCACGCGAACGTGTGGGAACGTGAGCATGTCGGTGGAGTCGTTTGCGTCCATGAT
GATCGTGTCGGCCAGCACGGGTCTTGTGTTTGCCAAGTTTGCCAAGCCACAGGCCAAAGTGGCGTTTAGTAAAGTTTGTGTTGTGCAGCCGTACGGCAAA
AAGTATCTTGCGCTTGTGGTGCGGGTTGCAAATGCCACGCAGTCACGTGATGTGACGCACGACGTCATCATGGAGGCTGTATTCAAGGTGAATTTGCTGC
GTGTTGAGCACAAGACTAAGCACATTCGAGCTCACGATGACGAAGTCTCGGAGAAGCGAAGGCTTTCTCGTGCAGCTAATTACGTGATAAACGAAGCTGA
AGATGCAGTGGATAACCCCGCTTGCTCGCCTACAAAAGTGCTTACATCGTACAACCTCAAGCTACTGCAGAACAATTTCATCACCTTCCGTATGGGCGTA
GCCGTCGTGCACGTGATTGACGAAAACAGCCCGTTGTATGGAATGTCAAAGAACGACATTGCTCAGTCGGATATGCTCGTAGAGGTTGCTATGTCAGGTG
TCGATTCCACGCTGCAAGACACAGTGTCCGAGCGATACATCTATACGGCAGTAAATTTGATGTGGGGGTATCGTTTTGCTGAATTGCTGGAGTTCAACGA
GCGGAATGCAGAGGTCATTATGAACTTCGCAAAACTCAGCACGGTGGAATCCGCTCCAATCGACGATGCCCGCTATCTCAAGCCAGTTGTCTCGAGTGGA
AAACCTCGTGGGAGTAATGAGAGTGCAAATAGCGGGCACTCGCACAATGTAGCTGACCGCCGTTCGCATCATAAGTCAAGGGTGTCTAGCCACCAGGAAG
AAAACCACCCGTATCATGACGAGGCAATTCATGAAGTTCCGGCAGAGTATTCGGAGCCTTTCATGGTAAGCTCAAGATCAGGATCTTGGGACGCCCAGTC
ATCAACAGACCACGCGATGCCCGCACAACCACACCCTCCAGTACAGTTCCCGAAGAAAAATGGACCAAAAACGTTTGCAATGGGTCTAGAGCCTCTGTTC
GAACCATTGCTGCAGCAACCGTTTGGAACACAGCGGATACCAAAAGCCCCTTCCGCTGAAGCTCGAGCCGCTCAAAGGGGAGGACTGCGTGTCTTGAGGG
CAAACGAGCAGGTAGGCCTGGAGGATGGTCGGGGCGGACAGGCTTTGACTGCAAATGAAGACATTAATGCTCGAGGCCGCGATAGTAGCGGGGGTGGGCG
TAGCAGCGGTGGTGGTCGGGGCTCATTCGAAGGACCGAACCATGTTCGAGCGAAGGACCTGCTTCAAAGAGAAATGGCAGGGTCAGCTTTGATCGAGGAC
GACACGAGTACAATTTCTCAGGAGGAAGGGCACAAGGATGATAGTGACGATGCTGACAACGTCGACACTGATGCCAGTGACGGAGAAGACTGTGTGGAGG
ACGACTATGACCAAGATGACTATGACCAAGATGATACTCCTCGGCAACGGTTGCGGGTTCAAACGACTATGTCTGCAGTGTCGATTGAGGTTGAGGACAC
GCCTCGCTTCTTGCGCATTCTTCCTGTCCACATCCCGAAGTCTTTCAGTTTCATGCGGTTCTACCAGAGTGCTCTCCATGTGGGCTGGCCAAAAATCATT
GTTGTGTTCGTACTATCGTTTCTAGTACTGAACTTCGGCTTTGGTCTGCTGTACTGGTTTGACGTGAGCCACATCTCAGCGTACACCGATGTGGTAGTCT
CCGACTACGAGTTGGCCTTCTACATGAGTGTTCATACGCTTGCTACGATCGGTTACGGCTCGATGGCCCCGATGCCTGATGCCGTTTACATGAATGTAAT
CGTGTTCATTGAGTCGATGGTGGGTATTATCGCCGTGACAATCATCACAGGCATCGCCTGGTCCAAGTTTGCGCGACCCCGAGCACATATCCACTTTTCG
TCCAAGATGACCATCTCGACCATCTATGGTCACCGTTGCCTCGTTTTCAGAGCTGCTAATACAAGGCACTCCGGCGAGGTGCACGAGAACTTTTTCCGCA
TCGGCGTGATCCTCACAAACCGACGCACAGGGCTGCGCCAGATGTACGACGTGCCCCTGGTTACTGCTGAGTGGCCGTCTATCAAGCTGCCAGCGACACT
TATCCACGTCATCAACGAAAACTCGCCGTTCTACAAGTTTCACTCGATGGAGGACTTATCGCAGTCGCGCGTCGCAGTCATCGCTTTGCTCACAGGCCTC
GATACGACTTTCTCGGAGAATGTGTACGCGCGCAAGATGTACTTCTGGGACGATTTTGCGTACGACATGCGCTTTGCTGACTTCGCCGTTATTGAGCGTG
ACCGCGTGATCGTGGACTACGACCGCTTTGATCGACTCCTTCCAGAAGACCGAGAAGAGCAAGTTATGACCACTCCTGTGCTCTCTGTGAGGTTTTCTAT
CGCTGACTCAGTTTAATGTAAATGGTAT