Description :
From Genome Similarity Track
Location :
Scaffold_915:6875- 11637
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_915-snap-gene-0.2ATP-binding Cassette (ABC) Superfamily
Pytul_var.sporangiiferummaker-pug3_contig_915-snap-gene-0.4Transcription factor
Pytul_var.sporangiiferummaker-pug3_contig_915-fgenesh-gene-0.1Qc-SNARE protein, SYP7-family

Sequence
4762 bases(100 bases per row)
ACGCGTAAGTTACGAGGCCATGGCATATCCCACAGCGAAGCTTTATGAATCACTGTCAAACTTCTTCGAGACGAGTAGTTTAACAGTTCATTTTTATTAA
TCCTTTTTTCGACATTATGTCGGATACTTGTTTGTGAACGAATCGAGAGAATCTGAAGGATGCGCTCACAGAAGACGATGACATTTAAGGAGCAGCATCA
ACTATGTACTAAAACATCGAGCGAGACACCTGGATACACATGCAGGGAGATTGCACAAGTAGTGGAAAGGCTCTCTACTCCCACTTTTGCCTCGCGACAA
ATACTTCGAAAAGGTGAACCTCACCATCGTGCGCGATATTACGTTTAAGCCATGAGTGCCCCAAAATCCAGTGCCAGGTAGGGCTGTGGGGTGTGGTACG
AGTGTAGGACTCAAAGTCAGTACAGTATCCGGGAACAAAACGAAGCCGTGAACGACGCATATTCTTGCAAATAGTGCCTATAATATTTGGCCATACAGTA
CCAGCATCGTTAAGACAATAATCTTAGCGTAGGACGGCAGCATCAACAGGTGCAAATCTTAACAAGAGGGTCATGGCGGCGAAGATCCCAGCTAACAGAT
GGCGAACACGAAAAGAGCAGCGCTTATTTGTAACAGCTCATGTTTATGGTCTCCAAGGAATTGTGGGTCTGTTGGCGAATTTGGCGTTGTTGTGTTGTTG
GTAATCAATTTCACAAGTACAATAATTCACATTAAATTACGCACAGACTCGAAATTTATTGCCAGAGTTTGCAATGAGTAAGACACACCAGAAGGGGGCA
AAACCCTCAGGGAATAGTTTTGAGGATTCACTCTGATGAATACAGTGGGACATGAAGAGTGTCGGTGGTGCTGTGTTCTTCAACTATGAATTCCGAGGGT
GCGTCCGATCGGTGTTTACGGAGATGGCGTGGATTACATCGGGCCAACGCCACTCACCACAACCCGTAAGTGAAAATACATCCAGTCCGAGGCGGACACC
CAGAGACAACGAGCTACGCTTTCCCGCCACCACACCAAATGCGGACCTCGTTTCCCATTTTCCTTTCGGATCACTCGCGCGCGCACCAAGTACCTCACAA
GCAATTACCCAGCCAACATGCCAGGAAAGGCCACGACAATTTTTGCGCTCAGCGCCGTGCTAGCCTCCATGCAAGTTGCCGCCATGCCGACCTATGTCGC
TAAAATTCCTAACGGTGCCAACGTCGACGGCGTCCAAGCACTCGGTCACGTGGACCCAGAAGGTGGTGGCGCCCGTAACGCGTTCGGTACTGCCTTCGGT
GCTGGGGGCCACACCTGGACCAAAGAGCTTTGCGAAGCGGATTCGGATGGAGATGGCCAAACCAATGGCCAAGAACTCGGTGATCCTTGCTGCGCCTGGG
TTGAAAGCTCCAACGATGTAGTGCTATGGTCCAAGGGTCTTTCTCACCCAGGGCTTGCCTCGTCCAAATCGGACCCTTCGCTGTGGGCTAGCGTTTCGTG
TGGATCTGCATCCAGCTCCGCCGGGTCATCGACAGCTAATTCGACTACCACTACCGTTACTGCTACTACGACCCCTTCGACCACTACTGCCACCCCAAGC
ACAACTACTGCCACCCCAGCCGCTACCACAGCCGCACCATCCAGCGCTGCTGCGTCGACTTCAACGTTCACATTGATCTCCGCGACGGCTGTCGTTGCAG
CTGCTGTTTTTGCGTAAGATGCTTCCTAGGAGTTGGAAACTTCACATCAGCTCATAAAGATAGCGTTTGTAAGCCCTTTTGTATATTGTAACAAGTGCAA
TTTGACTCTTGCTTTATTCAATTTTTGTTCTGACACTCATACTCTAAGCTGGTTGAGTGTTATCCCATCGAAATTCTTGCCAACAACTTACTGCTCTTTA
TATATCTACTAAAGCTGTCTTGCATCGATTCAGACGATTTTCATAGGCTAGGAAAACGCCAAACCCTGGCCTCGTGTGATGTGAAATGGACTCTCGTCTC
CAGTAGTTTGATGTGTTTGGCATCGATTGCCCTTTCGCACCGACCGATCGCACCCCGACACTTCACAGCGCCTCCCGCCACCATGCGAGATGCAGTACCC
ATTGCCACGATCTTTCTTCTTACAGCCTTCTGTGATACAACGTCGAATGCCGCCATGGAGATAGCATAGTCCAAGTCGTTGGGTTCCTTTCGTGCAGCCA
GAGATACGGCACTTCTTTCCACCTCCATGCGCTCGGCAAAGACCACCACCTTGCGAGCTTTTATCACAACCCGACATTTGACAGCGCGCACCACCACCGT
GAGTTTTGCATCGATTATTGGACTGAGCCCGACGATCGCAGCCCTCTACAATGCATTGCTTGGCTCGTCGTGAAGGCTTTGCTTTTTCGACCACGGGCTG
TTTCTGTGTTGAAGAGGAAGCTGCAGCAGTTGCCTTCTTTTTCGACGTCGTAATGGTTCGAGTTAATTTCGCCGTGGCTACTGATGGAGGCATCGAATTC
GAGGGACTAGGGGCAATAAAACTGTGCGGCAGTGGAGTGACTCGCGCTGGAAATGACGCGCTTGAAGGAATGCTGATTGGAGGCGGATGTTGCTCCCCTT
TCCAAGACGGTCGAGTAGACTTGGTCCCGGAATCCACAATATCTTCCCACGACTCGCGAAGGAATGAATCCATTACAGGGGATAGCTCAGGCGCCGCGCC
AAATTCTTGCTTGATCAAAGGTACCCCTCCCGAAGCTTGGCTTGTGTAGGAAGAGGCTCTTCCGTTGACTCGCAATTTCATGTCCGGAGACATGTACGAA
GGGTCGAAAAACGCTGGATGTTCTTCTTTCATGATGCCGAGTGATTCTGCGTCGTTTTGGGAGAATAGGTCCACCAAGCTTGTCAAACTGAAATCCAGCG
GTTCGGCCGAGTGTCTCCGAGACACAGAGGGCCCGCGAGGTGTTCCTGCTGCGTCAAACATCATCATCGTGCTTTCGAAATCCACATCTTCAAGCAAATC
CGCAGATCCGGGTAAATTCAGCAACTCGCTAATGCTTGTGGTTGAAGCATTGATCGTCGAAGAAGTTGGTGTTTCCATGACAGCCGCTTCTTTCGTTCTT
TTCTCAGCAGGAGCAACGGACTGGTGAACGAGGACACTGAAGTCAATCGCTCCTTGATTAACTGGCACTTTCGACAATGAGCTGCGGTAGGAGATGAGAT
TGACGTCGCAACAGATTACAATAGCGCTCTCACCATTAAAAGGAATAGCTGCAGCGACTGAAGAACTGTTTAAGGACAAGTCTGTGAGTACCAGTCACAC
AAATATTTAGTATCCGATAGCCACCCCTTGCTTCATCATATGCATCACCTCCTACACAATCTTATCCTCAGGCACCAGCAGGTGCAAGTATCGAATACTG
ATCAGGAGGATGCAGTAGAGTAACAAAACTCAGCATTGCCGTCGGCTCAGGACGAAGTCACCATCGTCACATGGGTGGACGAGGACTTCTTAGCGTGAGT
GACTGTAGTACAGTGATGGAAGAAGACATGTGAACCCAGCACAACCCCGCTGCGCTAATGCAACTGATAACTATTACAAACCCGTTTAAAACGATATAGC
TTCACTCAACCAGTTCCTGGCGCAAATGTACCATTCAAAACGATAGCGCTTGAAGGAATCTTGGCTTGGCTAACGAAGACACATTTCTGCCGGCACCAAC
AGTGAGCTTGTGCATCTGCAACGTGGGTAAATAAAGCCACCGCAATGTGATGTGGGGTGGGTTATGTCACAACCTATCAACCGAGAACCTATTGTAGTCA
TATGAGTGCTACTGCACTTATAAGGTGAGCGTCGCTTGTCTACGCAATTGGAATGAGCATAACGGTTGGTGCTCACGACAGTAGCAAGACAAAAAACGAA
GCGGCAGAATTTCGTAGTACATCTTCATCACTGAGCAGTACTGTATTCATTTCCATTCACAGGCAGGAAAAGCGAGACACACATTTTAAGAAAAAAATAC
TTGCGTTATATCGGTGCCTCGTATGATAGATGCTGCATCGCAATGGAAATAAAGATCGCCCTCACGTCATGATGACAAGGTACGTGAGCAGCAAAAGTAC
AAAAACGAGCACGATAATAACCACGAAATTCTTCATTCCCCCTGTTCAACAGCACAACACCATTCGTAAATACTATCCAAATCCGCCACTGCTCGCGCAA
ACAATCATACACATACTCGTACCTGACTGTTCAATCAGCTCTTTGGTTTTCTTCGTGACCGCCTGCAGTGCTTCTGAGGCTTTATCTGTTTCTTCATTTA
AATCATCCAGCATGCTGCACACCAACAAACATAAAAACTGTGAGGCTACTTTTTCCAAATAAACCATACTGTTGCAACTCTGCACGTACGCATTTTGTGA
GTCTAGCTCGGTACTAATCGATAGACTCATGTCACCAAGACGCTTGACTGCTGTATGGAGCTGATCGAGGCTCTCATCCTGTTTCTCGCGCTCCACCTAT
TGCATTGTACAACAGAAGCCATCAGCACAACTTGCAGTTAAAAAAGCAAGGTATCCGCAACCACGCAAACAAGAAAACACACTTGTTGCTGGTTGCGCTC
TCGTTGAATATAGTCATCTTCTTCACCGTCGGGCTATGTTCATAGACAATAAGGCAAATTATACTCCGAAAAGGGCGTCGATCATCATCATCATCGTTCA
GCGAGGACGCACGTCGTTGGAGATCTTGGCGTAGTTTGCTGGTTTCCCAGAGGGAAACGGTC