Description :
From Genome Similarity Track
Location :
Scaffold_13:68746- 72390
Transcript NameFunction/comments
Physo_130827reverse transcriptase

Sequence
3644 bases(100 bases per row)
GTGGGAGAACCAGGCGTTACGACTCCAGAAATGGACGCTCAAGTGCGAACGATTTTGGAAAGACATCATGCCAGTTTTCTTGGGGACGGGAATGCAGTAC
CGGCCACTGCTCGTGGAGTTGTCTGTGACCTGGATGTTGGGGACGCGAAGCCCATCGCTCAGAGGTCTCGGCAGGTTCCGACGCACTTGCTCGACAAGGT
GTTCGCTCTGATCAAGAAGCTGCTGGAGACTGGGCTCATCAAGTATTCGCACTCAGACTGGGCTTCGCCAATTGTGATTGTGATGAAGAAGAACGGTGCG
GATATCAGGCTGTGCATCGACTATCGACTGGTCAACCAACTGATCAAGCTCTCACACTACCCTCTGTCCTTGATTGACGATCTGTTGATCGGGTTTGAGG
AGGCGATGTGGTTCCTGAGCTTGTACATGACCAGCGGGTTCTGGGCAGTGCCGATGACTCTCCGGGCTAAGCTGATTTCAGCCTTCATCTGTCCTTTGGG
ACACTTCCAGTGGAAGCGCATGCCGTTTGGTCTCAAGAATGCCCCGCTGATGTACCAGCAGATGCTCGATAACTGCCTGTGGGGCTTCGTGCGACTTCCG
CCCTGCGAGGAGGCCCGAGTTGGCCCGGACGTGCTGGAATTCCTAGACATCGAGGTGGACGACTCCGCTAAGGAGGAAGAAATCTCTCCTCTGTCTGAGG
AGACTACCGTGTTTCGGCGAAACATTCCGGCCCCGCCTCAGCTGAGTCCTGTTCTGGGACGAAGCTCCTACATCGATGACATCGCGTATGGAGCAGAGAC
CTGGGACCAGATGTGCGAAGTCTTGGACCGGTTGCTTTATCGACTGAGGTACTGGGGGATTTCGGTGAGCTTGCCCAAGAGCGAGTTTGGCAAGAAGTCT
ATCTCCTACCTCTCGCACGAGATTGGAGCTGATGGAATCCGGGCCAAGCCGAAGATTGCCAAGGGAGTCAAGGACCTGCCATTTCCGTCGACGCTGAAAG
GAGTGCAGTCATTCCTGGGAAGTCTCAACTACTACAACAAGTTTATTGAGGACCTCCCGGTTGTAGCGTCTGTGCTCTACGAGTTGACGGATGAGCAGAT
CCAAGCTGGACGCGATCTCGGCCGAGCTAAGGAGGCGTTTGAAATCCTGAAGTAAAAAATTGTCTCTACCCCGCTGCTCAGACACCCGAACAGGGAGAAG
CCGTTCGTGATTATTCTGCACGCTAATCCCTGGGCAGTATGTGCGGTGCTAGGCCAAGAGTACGATGGAGTCATTTACCCGGTGCGAAACACTGCATGAC
AGGATGCTCAGATACCACCCGGCTGATAAGGAGGTTGCAGCGTTGCTCCGAGTTCTCAGAGTCTTCTACTCGATGCTGAGTGGTTGCAAGCTGCTGAAGG
TCTACACGGTTCTGAAATGGTTGTTCAAGTATCGGTCTCTAGAGGGACGCTGTGAGCAGTGGGCTGCACGTCTGTCGCCCTGGCCTTTGGAAGTTCACAA
GGTCGAACGCGATGAAGATGGTTTGGCCGCGATCATGGGAGCTGGGATCACCCCCCGTGACCAGTTGGACAAGATCGCAGAGAACCTCATCCCAGACAAG
GGACGAGTTGTCCGAGCCCCACCGATCAGCTTGGAGATGCTGGAGACGGACTACTAGGGATGGCTGCTCAGCTTTGATGGAGCTGCCAAACTCTCGGATC
GCTCTGGTGCTTCTGGCTGCATTCTGTGGAAGCTCCCATCCTGGGACGTGGTCGAAGCTCGAGGATTCCACTTCGAAGGCATTACGGTGAACGAAGCCGA
GTACCATGGACTGCTCGAGGGAGTTCGCATGGCGAAGGCTCGTGGCATCTCAGACCTTGTGGTGGTCGGTGACTCTCGGATTGTCATTCAGCAAGCTCAG
GGCCTGATCCAGTGTCTGAGCCCAGGGCCGCAAGTGCTGCTGGCTGAGTTTGAAACGCTTCGCCCAGAGTTCCAACGATTGCGCTTGGTACATGTGAAGC
GAGAATATAACGCAGCTGCGGACTACTTCACGTCGAAGACTCTGGTGACTGAAGGTCCTGTCGCCATTGAAGATCCGGTTGAACTGGTTCTGCTCAAACA
ACTGAATCGGATCCCGGAGAAGCTGATCAAGGTGAATGAGACTGAGCCTGCTGAGCCTGAGACGGAGCAACCTGACACTCAAGCTGATGTAGAAGTGGTG
GCTGAGCCAACTCCACTGGAAGATGCTGCCAAGCCTCTGTTGCCCAGCGCTAAGATCTTCGTGGTGACTAGGAGCCAAGCTCGGGCCAGGGACGCTGAAA
CCACAGCAGCCAGGGACGAGTCCGACCAAAGTGTCGATCCTGACCAGAATGCTGAGCCCCCCGCTGACCAGGCTCCAGTGTACTCACCTGAAGCAGCAAC
TCCTGCTGCGTCAATCGCTGAACGATGGAGACGCATCCTAGTTCTGCAAGAGGCTGAGCCTTGGACGAAGAAGCTCAAGGATTATCTGAATGGAGACTTG
GGGAACCTCTCCGCTACTGAAGCGGAAGATGTGGCCAAGGTGGTGGACCAGTTCACCCTTGATTCGAGAGGAGTCCTGTACTATCTGAGTCGAGCTACTC
CGGGAAGGCCCAGGGACGCAGTTGGGAATCTGAGATTGGTTGTGACAACGGCGCTGAGGGATGACTTGCTTCAGCTCAGTCATGAGGAGTTCCAAGGTGG
CCATCAAGGGATCACTAGGATCTTCGAGCGACTGTGCAAGGAGTACTACTGGCCGAGGATGTACGCCGACGTGGAACACTATGTGAAGGAATGTGTGGAT
TGTGTCACTGCCAAGGGAGCTCCGCCCAACCCTGGGCCATCGCCGGGAATCATTTTGGCGACTAAGCTCTTTGAGGTGGTCTCTATGGACTTCGTTACGC
ATCTACCCAAGTCTGACCGTGGAAATGTGTTCCTGCTCCTGTTCCAGTGTGCATTCTCAGGCTTCATCATGTGCAAGCCGATGAGTCTGACCACAGCTTA
AGATGTCGCCGAGGCCTACATGGAGTGTGTGTTCCAGAGGTTTGGTGCGAGCTCTCTACTCCGCCATGACCGTGATCCACGTTTCATGAGCGAGGTGTTC
GCCAGGTTCCGCGAGATGCTGGGAAGTCGGCAGCGCGCGACTCTGGCGTACAGACCTCAGGCAAATGGCCAGCAAGAGCGCTCAGTGCAAACAGTGGTCC
GAGCTATCCGAGCGTACGTCGCTGAGCCAGATCAGAGCGACTGGGACGACCAGGTAGAGAAGTTGATGTGGGCTCTGAACACGTCCTTTGACGCCACCCG
TCTCGACACGCCGTTCTACCTGGTCCACGGCTGGGACCCTCATAGCACTGTTTCGGCCATGCTGGGACCATCTCCGACGGGCTTGGATCAGAGGACTGCC
TATGAGTGGCGTCGCAAGACTCAGCGCGAGTACGAGTACGCTCAGGCCTGGGCTAAGGACTTACAAGCTGAGGCCAAGGTCAAACGCTCAGCTGCTCAGA
CAAAAATCTGGGCTGAGCTGTCCGAGAGACTCAAGAAGGATTTCGACGTTGGTGATGCTGTGTGGCTATACCTAGCTCGAGTACAACCTGGGCTCACGAA
GAAGTTCGCTCACCTCTGGCACGGTCCGTTCCGGATTCTGGAGA