Description :
From Genome Similarity Track
Location :
Scaffold_19:68736- 70112
Sequence
1376 bases(100 bases per row)
CTTTCTGGTTACACTTTGTACCCGGTACACTGTACCGTTTGGGTTCCTGATTTTCCTCATGCCAATCAGCTTCACTTTCTTTCTTTGTAGACGAAAATGG
ACGAGGGCGCGAAGAGCGATGCCGCAGCTGCACTGGCACTGGCGCTCCATGAAGCCTGTCGAAGTGGATGCAGAGGAAGTGTCAGTGATGCTTCGTCCCA
GTAACGTCTTGGTGGATACGCTCAATGTGGATATTCACACGCCGTTGACGACAGCAGCCGAGCATGGACATGTGGACGTCGTGAAGATCCTTTTGGAATT
TGGCGCTGATGTGAACGTGTGCGATCGAGTTGGAGCTACACCCTTGCATGTTGCGGCTCAGCGCGGATATGCAGACATTGTCACTTTGTTGCTTCAATCT
ACCGCCACCGTTAACGCAGGTAATACCTGTGGGGCGGCAGCACTGCACTATGCTGCTCGCCATGGGCACGCAGGCGTTGTTGAAGTTTTGATTCAGAGCC
CTGCCAACGTGGACGCCGTAGATTGAAATGGGGCATCCGGTCTGCATTGCGTCGCTCACTATGGCTATGAAAACGTCGTAGACGTCTTGCTTTGAAGCAA
CGCGGCCGTGGATTCCCGAGATGTTCATGGGAAGACTCCGTTGTTTGTTGCAATACAAGAAGATCGCACAAGCATTGTACACAGGTTGCCGCATGCCAGG
GCTTCGGTATATATCCAAGCTGCCAACGGTGAAACCATCCTGTTTTGTGCTGCTACACGTGGTGACTTCAAGACGTTTGATTTGATCGCGGATTGGATTG
TTTCAAATCCCAACTCCAACTCAAGTGCTCATTTTTTGCTTCTCGCGCTTACTCTGTAAAGCTGCGTAATTATGCTCTCGGTGTACACGAGTTCGAAATG
ATGTGGAAAAGTGTAGTCAATCGCCTCGCAGTCGTTGATGTCGAGTTTCAAGAAGACAATAGTCAAGGGGAGAGTCGCGACAGGGTGCGCCGTCTGATCA
TGCTTACATTTCGACTTGTCAAGCTAAAGGCGGTTTGTGCGAGAAGAAGCGTTTACTTGCGACTTGTTTCAGCTCGAAGTGTTGTGAATCATGTCCACGA
TATCCAAGTCGAGGTCAGTTTTTTGCAGTTTTTGCAGGGAACGAACAATTTGGATGCCAACTATCCCACGGATGAGAACTGGCTTATGCGATATGAAAGC
GATCAGATAAATTTGTATCGAGCATTTAAGCATTCGCTTGAAGAGGAGAGACGCCGGAATCAAAAAGTGCTGCGTCCAACCACTATTGTATTAGCCAGCA
AGGCTTTGTAATATGAACTGGAAGCATATGGTGATAAGTGTAGTCTGCCGATATTGCCATATCATTGTCTGCATAT