Description :
From Genome Similarity Track
Location :
Scaffold_247:6871- 12304
Transcript NameFunction/comments
Phypa_INRA-310PPTG_20019secreted RxLR effector peptide

Sequence
5433 bases(100 bases per row)
CCGATCCAGTGTCGATACCCGATCCTGCAAACGATCAAGCTCGGCGGAGTGTATGGCGATCGTGTTGTCGGTAACCTTCAAACGACGCTCATAGTTGTCA
CGCAAGGTGCGGAAGCGACGAGACTTGCGCTCGATCGCGGCCTCGAGTCGGTATACTTCCTCTTGAGTCGCCTTGTGAGACGTAGCTGATTCACGAAGCT
CCGAAGCGAGGCCAGACTGACGATCGCGCGCGACTTGCAAGTCAGATTAGGACCGTGCAAACTGGGACTCCAGATCTGCTATACGACTAGCTGTGTGAGG
CGGGAAAATCACGCCAAAGAAAGGGGTGGCGGCCAGCTGCGTCACCGGGGTAGAGATACGATCGTGGAACTCGGACACTGCTTCGCTGTACCGGATCTTC
AAATCGCGATACCGAAGACGGCAAGCCTCAAGCTCGCGGGAGTTGTCCAGACGCCAAGCTTAACTCATAGCAAATTCCAGGACCCTACCTCGAGTTAAGT
GCTCTTCTGTGGTTGTTAGTGGTGGTTCACGCATGGGCGTCTCGTGCTGTTCATCCAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGAGGCCCTAAACACGAGTGAGAAAGCTTTGCTCTCAG
TTTGTGACCAAGCGCAGGATTTCCTATATAAACCGTTTAGTCATCCACATCTTTTACAGGGATTGGAATTTGAGAGATACAACTCTTCGTCTAAAATTCG
AGTGGCGACGACATATTATAAAGCTTTTTTTTTTTTTTGGAAAACAACTGCAGGCGCGTTTACAATCATTTTAATTGTGGTGTGTACAGACAACGATCGA
CACCTCTGAATACCATCCCGTCCATATCACAAAGTCCCGTTTCATAAAACATACGCAAATGGTCATAAACCACACGTAATTTCAGAGAAAGCACAAAAAC
ATACGGAATACAAAGACCAAGTCTGATGGTAGATTCCTATTGTTACTTGCACGGCTTTGTTCGTCGGATTTTTGTGTCTGTCGAATAAATGTGTCGTATC
TGTATAGCACTGGTACCATATACCGCATCGTTGAATTCATAAAGCGTGCATGATCCGCAAAGGGATTGTGGATTTAAATATGTGGTTAGCTATGGTTTGT
AGTGATAATAGAAGTGTTTTTAACTAGCTATGAGTAAGTGCGTTTTATGATGTATGTCCGAATAACGAAATCAACTAAGAGTTTAATACTAGTAACGCGT
TTCCCAGCGTAAGTCGTAGACGACCTAGTTTCGCTCTGCTCGGTCGGGCTTGAGGTGTCAACTCAAAATATGTATTTCAGCATCTAGGTGTTTATTCCGC
GGTGCAAGATTGCCTTCTACCATCGACTGCAACCTGCTGTAGGCATCCCAACACTTTTCAGTCGACCCAGCATGGCGATGTAACTGACTACATAGCTGTC
TGCCGTACGGGCCTCACAGGCATTCGATTTCGTTCATGGAGACACGACAAAGCCTCCATTTTCCGATGACGGGTTGTAAATTGCAAGCACAGTAATAACG
TTTTTACCGCGTAGAGGACGACTCCCTCCCCGTAAATGTATCGGTTTATATACAAAGTCACACGGCCCATCAATTACGCTAATAGTAGATGCTTGCATCA
ACACGACAAACATCTCACGACCAAACTTTCGATTGTATTTGTTTACTAGAAAGTTGTCCAGAATGACCTCGTCATGACTTTTTCGCACTGCCAGAGGGAA
GCTGCAGACTCTCTCTTTGCAGCTGAAGCTACTTTCCCGGGCTTCTATACGACGCGAGGACTTGAGGGAACCACCTTTTACTTGTTACTTTTTTTCAAAG
CATTTTTGATCGCCAGGGCCAAGTTGGCCTTCTTAAGCAGTTCTTTCATTTTCGGAGAGTCCGGCCTTGGGATGACTTTGTTGATACTCGTGCCTGCTGA
CTTGAAAATCCCACCGTACCCGTTCCCCGTGCTCTGGACAACTTCTTGGCCAGCGACTCGAAGGGATCTCTTGGCCTTGGCCGCAGAGTCAGGAGATATC
TGCGACAAGAGCCCAGACTCGTTGGGATGAGGGAACGCTGTGGCGGCGCTGCTGCGAGCCCAAGCAGCAAAGACAAGAGCGATGTAGAATAGACTGCACA
TGGATGTCTAGAGAGGGTGTCCAATGGAAGGAAGAGCCTTGTGGTCTTGAAAGAAAAACGTGAAATGACTGCTGGATGGCGTGGCTTTACAGTACCAGAG
AANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACGGCCGCCACTATTA
TATTCCGTGGAATTGACGCCATCCGATCATGCTCATGCCACTGGCGTTGCAAGTGCCGGAGGTGTCGATGATGAAGTCATTATGGTAGTGTATTGATTGC
CTTGAAGCCCTGAGTTAGGAGACAACATGTAATTTAATGTATTAACAATTAAGAGCGAAAGTAATAATAAAAAATGAAGAAGTTACTAAAACATAAAAGA
CGGTTAGGAAAATTACTGCGACATGAAAGTTCTGAATCCCATCCAAGCATATTTTATTACGCAGCGGACAGTTTTGTATCTGTTTTGGAATAAATCGGGT
TTTCTGACAGCAATTGTCAGAAAAGGGTAATTCCCATCTGGTCCAAAAATACATCTTCGTTATTCCACTGGAATTAAGTAATGAAACATCCATCGGTAAT
CTATCCGTCATTTATTCATAAATCTTTTACCCAGATTGCCAGGTCGCGCTCTTCCAAGTCAAAAATTCTCTATTATAATAAAACTACAGATGTTCAAATT
GCTTATGAGATTATATGAAGTGCATAAAGCATG