Description :
From Genome Similarity Track
Location :
Scaffold_2:68708- 73311
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2-snap-gene-0.51Intraflagellar Transport Protein 140

Sequence
4603 bases(100 bases per row)
GCGCTGTTCTACGACTACAATGTCCAGATTCCCTCGAGCCATCGCCATGTTTGCTCCACCTGGGGGGAGACAGACCCCATCCTAGCAGTAGCACTTGAGA
ATCGCGAAGTGCACTTCTTCACTGACGAAGTACGTCTGAGCTGTATTGAAAGTGGAAATTGACGTGAAGGTCTATGTCGCATCGCTGACCTCATGAATGG
ATATGATTCTGCACTGCGAACTGGCAGGGAGACAAAAGCCCAGGATATGAGACGTATACACGAGTCGCCGACATTGTGACGATGGCGTGGCAGCCCCGTG
GAGGTGCGCTTGCGATCGGCTGGAGCGATGGTATGTATGTGTTTGTCTGTGCGAATTACTGTAATACGCTCGGTCATTCGTCTGACGCGGCTTGCCATTG
TGCTTGCAGGTATGGTGTCACTGTGGATTTTCAAGGAGAACTCGGCTCGCGAGGTGAACTCGCCGCACACCAGTCGCGTGGGTCTCCTAAAGTGGGCGCC
GGCAGGAAATCGACTAGTTTCTGCGGATGAAAATGGCGTGTGCGCTGTCTGGAAAGTCGACAGTCGCTCGCAGTTGTCCCTCAGCAAGTCGTACACTCGC
CAAGGAAGCATCACGCACTGCGTGTTCGCCACCAGCCCAGCGCAACGCGAGAAGCTGCTGAAAAGGTACGACGACTGTTTGTAGCCTTCATTGCGTCGTG
TCGTATGCATGACGACACGTAAACTCACGCTCCTGCTCTTGCGCTCGCGATCATGACGCTGTAAACAGTGAAAACTTCTCACAGCACGCATGCCCAAAAT
TCTTCTTTGGTGGCGAGATCGGATCGGTACACTATGCGGACGATCTTGACCACATCACCGACATCCAAGTTCTGAACCACGCGATCGACTCGATGATGTT
CTACGAGGAGCACAATCGACTCATCGTGATCACTCGAGCGCTTCAGCTTCACGTATTCCAGGTTGGCACCGCGGATGGGACAGTGAAATCGACGTTCAAG
GTGAAACTCAGTGTTGCGGGCGACGGGAGTCTCCACGAAACTCGATGGGCAGGTCCGGGGCTGCTGGCGATCGCTTCTGGAGAGCCGCTAGTTCGCTTTT
GGGATCTCCAAGCGGAAGAAAACAGCGTGCTGAGCTTGCCGAAATCTGGGACAGTGAACTATCAAGTGAATAGCATCGACTTCTCTCCCCGGAAGCGCAT
CCTGGTGGCTGGAACAACTCAGGGCGTCGTGTTCTTCTGGCGTTGCATGTCACTCGCAGGTACTAAGGATGACGCCACTTCCGTATCGTATCGTTGGGAT
ATCATCTTCACCACAGAGGTCGGGCGAAGCATCACTCGGATCGGTTGGAGTCCCGTGTACTCGACGCTGTACACAAACACGTCCGAAGGTGTGGTGATCT
TGCACGAAGGGAACATGCAGCGAGCTCTCTGCGGCGACACTGCGGTCATTCAGAGCCACCCGAAGACGCTCTCGATTGAGAAGTATCGTGACGGCACTGT
CACGCAGTCGACGTTGGAGACAACTCTCCCTATCAAAGGTGTCTCACACGACACTGCTTCTGTGGTGATTTGGAGCGGATCTAAAGCGGAAGTGTATGAG
ATCAGAGATGGTGACATCAAGCGAATAGGTCAGTTCAAGTGCGAGTCGAGCGCACTGGTGGTCCGAGGCGACTCGATCTATCGCACGAACCGCAACCACG
TTGAGATCTGCAATGTACAGGGTGTGGTGAAGAACACCATTTCTTTCACGGAAGCGGAAGGCCGACCGGCGCTGCTGTCGCTGCAGAACAAATTTCTCGC
CGTGGGTACCGACCAGGGCTTGTTGCGCGTGTTTGACCTCTCTCGCCGTGATCCAAAGGCGATTGGCAGTATGGGTAATTTTCTGGAATCATATGGAGAC
GAAACCAGGACGTCGATCATGCGCGCGATCGCTGTGAATGCGGATGGAACACGAATCTGCATCCTCGCTGACAAGCTCGAAGGTGCGCTGAAGATCCGGG
TCCCGCTGAACAAACTCTTCCTTTTCCAGACGGATCTCAACATTTTCCAGCAATACGACTTTGGTGCCAGCAGAAGCCCAAACCTGGTGTTCTTTGACCC
GCACGAGCCTCGCTTACTCGCGTGTGAGACCTCAAAAAGCAAATCCGACTTGGCTCCTGCCGGAAACCAAGCGACTGATCCTGCTGTTCGACGTGAAGGA
GACGAGTCTGGAAGCAGTGCATCGACGACTAATGCTGCGTCCCGCCTATCTCTGTCTGATAAAGAAATCACGGTCATGTTCGCCTCGAACGATCATGGAC
TGCTCATGCAAGACAGCTTCGACTTGGAGCTGAAATACAACGCGCTGCTTGGCATCCAAGCTCCGCGCGTGTATTTCATCGCCCAGGCTGAGAAAAATTC
CACTATCGATGCAACCACTGTCGTCAAATGTGGAAGCAGCAAGGACAGAACGAACAGCCTCTCGAAGTCCTCCGCGAACAACAACGAGCCGTTCAGCTAC
CTGTCCACGAAGATCATGCGCGACTTTGTCGGACTCGACAAGGTGGACGAAAAAGGGAGAGAAGCACTCATCAATTTTTGCTACTACGTGACCATCGGGA
ATATGGACGAGGCATATCGCTCGGTGAAGCTGATTGAAAACCCGTCTGTGTGGGAGAACATGGCGCACATGTGTGTGAAAACGAAACGCGTCGATGTCGC
CGAGGTGTGCTTGGGGAATATGGGTCACGCACGAGGGGCTGCTGCAGTGAAAGAAGCGACACTGCAGCCTCAGCTGGAGGTCCCCATTGCCATGGTCGCG
ATCCAGCTTGGCCTTCGCGATGACGCCGCACGGCTCTATCGTGAATGCGGACGCTACGATTTGCTGAACAAGCTCTACCAGGCGAGCGGGTACTGGCAGA
AAGCAGTCGACGTCGCCTCGAAGCGCGATCGCATCCACCTCAAGACTACATACTATGCGATCGCGCAGCACTACGAGGAGATGGGCGATGTCAAGCAAGC
GATGGAGGCGTACGAAGATGCGGGCACGCACCAGAAAGACATTCCGCGGATGCTGTTCAAGTTGGGCAAGCTGGATCTGCTGCAAAAGTATATTTCCACG
TCCAAAGACCGCGATTTGATGATTTGGTGGGCTCAGTTTCAGGAAAGTCAGGGCCATTTCGATACGGCGATCGAGAGCTACGAGCGAGCCAAGGACTACC
CCTCGATTGTTCGTGTGCTATGCTTCAAAAAGGATTTCCAAGCCGCTGCGAAAGTCGTCAAGACGAGTGGCAATCGCGCTGCCGCTTACCACCTCGCGCG
GCAGTTTGAAGCTCACGACGACACCCAGAGCGCCATTTACTTTTTCGCTGCTGGCGGATGTTACAACCACGCGATTCGGTTGACAAAGGAACACCGCATG
GACGCTGATCTGATGAGCTTTGCTCTGATGAGTAAGCCCAGTGACATGCTCGAGTGTGCTGCGTACTTTGAAAAGCGTCGTGAAATGGAGAAAGCCGTCC
AGCTCTACCACAAAGGCGGCAACGTGGCGAAAGCGTTGGATCTGTGTTTCCAGGCACAGTTGTTCGAAGAGCTGCACCACTTGACGGACGAACTGGGTCC
GTCCAATACATCGCCCGCAATTCTCAAGAAATGCGCTGATTTCTTCATCACCAACGGCCACTACGCCAAGGCTGTGCATCTCTGTCTGATCGGCAATCGT
GTCAGTGAAGCACTGGACGTGTGCATGCAGCATGACGTCAAAGTGTCGGAAGAAATGGCGGAGAGAATGACTCCTCCAAAGGACGACAAGGACTCTGCAG
CTGGTGACAAAGTCCAACAGAAGTGGCGCACGGACCTGCTGCTCAAGCTCGCGAAATGCTGCAAGAAGCAGGGGGCGTACCATCTTGCGACGAAGAAGTA
CACACAGGCTGGTGACAAGCTCAAGGCGATGAAGTGCCTGCTCAAGTCCGGGGACACTGAAAAAATCGTGTTCTTTGCGAATGTGTCGCGCAACAACGAG
ATCTTCATCCTCGCTGCCAACTACTTGCAGAACTTGGACTGGCGTAAGGACTCCGAGATCATGAAGAATATAATTGGCTTTTATACGAAAGCGCGTGCGT
TCGACCAGCTCGCTGGGTTCTACAGCGCTTGTGCCCAGGTGGAGATTGAAGAGTACCGCGATTACGAGAAAGCGATCGGCGCGGTGCAAGAGGCGATGAA
AGTGCTCTCCAAGTCGCGCTCCGAGACGAAAGACAAGATGCTCAAGGCTTACGAGACGCGCATTTTATTGATGGAGCAGTTTGTCGTCGCGCGGCAGCAG
CTGCGCCAGAACCCGGAGGAGATGATCGAGATCGTGACCAAGCTGCTCGATGAGCCGGGGATCGACGAAGCGATCCGTGTCGGAGACGCTTATGCCATGA
TCATTGAGGCGCACTACAGCCAGGGCAACATGGACAAGTGTCTGGAGATGATGGATACTATGAAGCAGCGAGGATTGACGGTGAAGAACTACGTCGACCC
TCGCTTGATTCAAGAGGTGCAGCAGAAAATGGGTGGAGCTTCAGGAAACGATGCCATGGACAAGCACCGTCGTTCCGTGCAGAGTGAGCGCAAGATGGGT
GCT