Description :
From Genome Similarity Track
Location :
Scaffold_247:6870- 12330
Transcript NameFunction/comments
Phypa_INRA-310PPTG_20019secreted RxLR effector peptide

Sequence
5460 bases(100 bases per row)
CCCGATCCAGTGTCGATACCCGATCCTGCAAACGATCAAGCTCGGCGGAGTGTATGGCGATCGTGTTGTCGGTAACCTTCAAACGACGCTCATAGTTGTC
ACGCAAGGTGCGGAAGCGACGAGACTTGCGCTCGATCGCGGCCTCGAGTCGGTATACTTCCTCTTGAGTCGCCTTGTGAGACGTAGCTGATTCACGAAGC
TCCGAAGCGAGGCCAGACTGACGATCGCGCGCGACTTGCAAGTCAGATTAGGACCGTGCAAACTGGGACTCCAGATCTGCTATACGACTAGCTGTGTGAG
GCGGGAAAATCACGCCAAAGAAAGGGGTGGCGGCCAGCTGCGTCACCGGGGTAGAGATACGATCGTGGAACTCGGACACTGCTTCGCTGTACCGGATCTT
CAAATCGCGATACCGAAGACGGCAAGCCTCAAGCTCGCGGGAGTTGTCCAGACGCCAAGCTTAACTCATAGCAAATTCCAGGACCCTACCTCGAGTTAAG
TGCTCTTCTGTGGTTGTTAGTGGTGGTTCACGCATGGGCGTCTCGTGCTGTTCATCCAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGAGGCCCTAAACACGAGTGAGAAAGCTTTGCTCTCA
GTTTGTGACCAAGCGCAGGATTTCCTATATAAACCGTTTAGTCATCCACATCTTTTACAGGGATTGGAATTTGAGAGATACAACTCTTCGTCTAAAATTC
GAGTGGCGACGACATATTATAAAGCTTTTTTTTTTTTTTGGAAAACAACTGCAGGCGCGTTTACAATCATTTTAATTGTGGTGTGTACAGACAACGATCG
ACACCTCTGAATACCATCCCGTCCATATCACAAAGTCCCGTTTCATAAAACATACGCAAATGGTCATAAACCACACGTAATTTCAGAGAAAGCACAAAAA
CATACGGAATACAAAGACCAAGTCTGATGGTAGATTCCTATTGTTACTTGCACGGCTTTGTTCGTCGGATTTTTGTGTCTGTCGAATAAATGTGTCGTAT
CTGTATAGCACTGGTACCATATACCGCATCGTTGAATTCATAAAGCGTGCATGATCCGCAAAGGGATTGTGGATTTAAATATGTGGTTAGCTATGGTTTG
TAGTGATAATAGAAGTGTTTTTAACTAGCTATGAGTAAGTGCGTTTTATGATGTATGTCCGAATAACGAAATCAACTAAGAGTTTAATACTAGTAACGCG
TTTCCCAGCGTAAGTCGTAGACGACCTAGTTTCGCTCTGCTCGGTCGGGCTTGAGGTGTCAACTCAAAATATGTATTTCAGCATCTAGGTGTTTATTCCG
CGGTGCAAGATTGCCTTCTACCATCGACTGCAACCTGCTGTAGGCATCCCAACACTTTTCAGTCGACCCAGCATGGCGATGTAACTGACTACATAGCTGT
CTGCCGTACGGGCCTCACAGGCATTCGATTTCGTTCATGGAGACACGACAAAGCCTCCATTTTCCGATGACGGGTTGTAAATTGCAAGCACAGTAATAAC
GTTTTTACCGCGTAGAGGACGACTCCCTCCCCGTAAATGTATCGGTTTATATACAAAGTCACACGGCCCATCAATTACGCTAATAGTAGATGCTTGCATC
AACACGACAAACATCTCACGACCAAACTTTCGATTGTATTTGTTTACTAGAAAGTTGTCCAGAATGACCTCGTCATGACTTTTTCGCACTGCCAGAGGGA
AGCTGCAGACTCTCTCTTTGCAGCTGAAGCTACTTTCCCGGGCTTCTATACGACGCGAGGACTTGAGGGAACCACCTTTTACTTGTTACTTTTTTTCAAA
GCATTTTTGATCGCCAGGGCCAAGTTGGCCTTCTTAAGCAGTTCTTTCATTTTCGGAGAGTCCGGCCTTGGGATGACTTTGTTGATACTCGTGCCTGCTG
ACTTGAAAATCCCACCGTACCCGTTCCCCGTGCTCTGGACAACTTCTTGGCCAGCGACTCGAAGGGATCTCTTGGCCTTGGCCGCAGAGTCAGGAGATAT
CTGCGACAAGAGCCCAGACTCGTTGGGATGAGGGAACGCTGTGGCGGCGCTGCTGCGAGCCCAAGCAGCAAAGACAAGAGCGATGTAGAATAGACTGCAC
ATGGATGTCTAGAGAGGGTGTCCAATGGAAGGAAGAGCCTTGTGGTCTTGAAAGAAAAACGTGAAATGACTGCTGGATGGCGTGGCTTTACAGTACCAGA
GAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACGGCCGCCACTATT
ATATTCCGTGGAATTGACGCCATCCGATCATGCTCATGCCACTGGCGTTGCAAGTGCCGGAGGTGTCGATGATGAAGTCATTATGGTAGTGTATTGATTG
CCTTGAAGCCCTGAGTTAGGAGACAACATGTAATTTAATGTATTAACAATTAAGAGCGAAAGTAATAATAAAAAATGAAGAAGTTACTAAAACATAAAAG
ACGGTTAGGAAAATTACTGCGACATGAAAGTTCTGAATCCCATCCAAGCATATTTTATTACGCAGCGGACAGTTTTGTATCTGTTTTGGAATAAATCGGG
TTTTCTGACAGCAATTGTCAGAAAAGGGTAATTCCCATCTGGTCCAAAAATACATCTTCGTTATTCCACTGGAATTAAGTAATGAAACATCCATCGGTAA
TCTATCCGTCATTTATTCATAAATCTTTTACCCAGATTGCCAGGTCGCGCTCTTCCAAGTCAAAAATTCTCTATTATAATAAAACTACAGATGTTCAAAT
TGCTTATGAGATTATATGAAGTGCATAAAGCATGGCATCATAACGACACGATGGCCGAGT